ID: 1098713843

View in Genome Browser
Species Human (GRCh38)
Location 12:73802983-73803005
Sequence GTAACAACACAGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098713843_1098713846 6 Left 1098713843 12:73802983-73803005 CCAAGTTCCATCTGTGTTGTTAC No data
Right 1098713846 12:73803012-73803034 CAGGATTTTATTCTTCCTTTTGG No data
1098713843_1098713848 24 Left 1098713843 12:73802983-73803005 CCAAGTTCCATCTGTGTTGTTAC No data
Right 1098713848 12:73803030-73803052 TTTGGTTGAATAGTATTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098713843 Original CRISPR GTAACAACACAGATGGAACT TGG (reversed) Intergenic
No off target data available for this crispr