ID: 1098716130

View in Genome Browser
Species Human (GRCh38)
Location 12:73830108-73830130
Sequence GGCCTCGCGGGGAGTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098716121_1098716130 7 Left 1098716121 12:73830078-73830100 CCTCCCTTCTCTCCCTCAGTCTG No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716122_1098716130 4 Left 1098716122 12:73830081-73830103 CCCTTCTCTCCCTCAGTCTGCAC No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716120_1098716130 8 Left 1098716120 12:73830077-73830099 CCCTCCCTTCTCTCCCTCAGTCT No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716119_1098716130 11 Left 1098716119 12:73830074-73830096 CCACCCTCCCTTCTCTCCCTCAG No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716123_1098716130 3 Left 1098716123 12:73830082-73830104 CCTTCTCTCCCTCAGTCTGCACT No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716116_1098716130 30 Left 1098716116 12:73830055-73830077 CCCATGCTCTCCACTCATGCCAC No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716117_1098716130 29 Left 1098716117 12:73830056-73830078 CCATGCTCTCCACTCATGCCACC No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716125_1098716130 -5 Left 1098716125 12:73830090-73830112 CCCTCAGTCTGCACTGATGGCCT No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716118_1098716130 20 Left 1098716118 12:73830065-73830087 CCACTCATGCCACCCTCCCTTCT No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data
1098716126_1098716130 -6 Left 1098716126 12:73830091-73830113 CCTCAGTCTGCACTGATGGCCTC No data
Right 1098716130 12:73830108-73830130 GGCCTCGCGGGGAGTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098716130 Original CRISPR GGCCTCGCGGGGAGTTCCCT AGG Intergenic
No off target data available for this crispr