ID: 1098720500

View in Genome Browser
Species Human (GRCh38)
Location 12:73891794-73891816
Sequence GGGTGTAAGCAGATGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098720500_1098720506 15 Left 1098720500 12:73891794-73891816 CCCTCCTACATCTGCTTACACCC No data
Right 1098720506 12:73891832-73891854 GTTGCTTAACCCTAAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098720500 Original CRISPR GGGTGTAAGCAGATGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr