ID: 1098722172

View in Genome Browser
Species Human (GRCh38)
Location 12:73914031-73914053
Sequence CAGGGTGACTAGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098722167_1098722172 20 Left 1098722167 12:73913988-73914010 CCTAAGGAAGTCAAAGGAAAAGA 0: 1
1: 0
2: 5
3: 95
4: 706
Right 1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098722172 Original CRISPR CAGGGTGACTAGATGGAAGC AGG Intergenic
No off target data available for this crispr