ID: 1098727508

View in Genome Browser
Species Human (GRCh38)
Location 12:73987162-73987184
Sequence AAGAGGTTGAGTGTAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727508_1098727515 10 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727515 12:73987195-73987217 TTTTGTCGGGGACTTATTGAAGG No data
1098727508_1098727512 -2 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727512 12:73987183-73987205 TTCCCTAGCTTTTTTTGTCGGGG No data
1098727508_1098727516 16 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data
1098727508_1098727511 -3 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727511 12:73987182-73987204 CTTCCCTAGCTTTTTTTGTCGGG No data
1098727508_1098727510 -4 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727510 12:73987181-73987203 TCTTCCCTAGCTTTTTTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727508 Original CRISPR AAGAGGTTGAGTGTAATTTC TGG (reversed) Intergenic
No off target data available for this crispr