ID: 1098727509

View in Genome Browser
Species Human (GRCh38)
Location 12:73987179-73987201
Sequence GACAAAAAAAGCTAGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727509_1098727518 17 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727518 12:73987219-73987241 TGTGGTAGCCCATTTGTTTAGGG No data
1098727509_1098727516 -1 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data
1098727509_1098727517 16 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727517 12:73987218-73987240 TTGTGGTAGCCCATTTGTTTAGG No data
1098727509_1098727515 -7 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727515 12:73987195-73987217 TTTTGTCGGGGACTTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727509 Original CRISPR GACAAAAAAAGCTAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr