ID: 1098727511

View in Genome Browser
Species Human (GRCh38)
Location 12:73987182-73987204
Sequence CTTCCCTAGCTTTTTTTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727508_1098727511 -3 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727511 12:73987182-73987204 CTTCCCTAGCTTTTTTTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727511 Original CRISPR CTTCCCTAGCTTTTTTTGTC GGG Intergenic
No off target data available for this crispr