ID: 1098727514

View in Genome Browser
Species Human (GRCh38)
Location 12:73987186-73987208
Sequence AGTCCCCGACAAAAAAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727514_1098727518 10 Left 1098727514 12:73987186-73987208 CCTAGCTTTTTTTGTCGGGGACT No data
Right 1098727518 12:73987219-73987241 TGTGGTAGCCCATTTGTTTAGGG No data
1098727514_1098727517 9 Left 1098727514 12:73987186-73987208 CCTAGCTTTTTTTGTCGGGGACT No data
Right 1098727517 12:73987218-73987240 TTGTGGTAGCCCATTTGTTTAGG No data
1098727514_1098727516 -8 Left 1098727514 12:73987186-73987208 CCTAGCTTTTTTTGTCGGGGACT No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727514 Original CRISPR AGTCCCCGACAAAAAAAGCT AGG (reversed) Intergenic
No off target data available for this crispr