ID: 1098727515

View in Genome Browser
Species Human (GRCh38)
Location 12:73987195-73987217
Sequence TTTTGTCGGGGACTTATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727509_1098727515 -7 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727515 12:73987195-73987217 TTTTGTCGGGGACTTATTGAAGG No data
1098727508_1098727515 10 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727515 12:73987195-73987217 TTTTGTCGGGGACTTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727515 Original CRISPR TTTTGTCGGGGACTTATTGA AGG Intergenic
No off target data available for this crispr