ID: 1098727516

View in Genome Browser
Species Human (GRCh38)
Location 12:73987201-73987223
Sequence CGGGGACTTATTGAAGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098727508_1098727516 16 Left 1098727508 12:73987162-73987184 CCAGAAATTACACTCAACCTCTT No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data
1098727514_1098727516 -8 Left 1098727514 12:73987186-73987208 CCTAGCTTTTTTTGTCGGGGACT No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data
1098727509_1098727516 -1 Left 1098727509 12:73987179-73987201 CCTCTTCCCTAGCTTTTTTTGTC No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data
1098727513_1098727516 -7 Left 1098727513 12:73987185-73987207 CCCTAGCTTTTTTTGTCGGGGAC No data
Right 1098727516 12:73987201-73987223 CGGGGACTTATTGAAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098727516 Original CRISPR CGGGGACTTATTGAAGGTTG TGG Intergenic
No off target data available for this crispr