ID: 1098728998

View in Genome Browser
Species Human (GRCh38)
Location 12:74008900-74008922
Sequence CTACAATCCTGGGCTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098728994_1098728998 8 Left 1098728994 12:74008869-74008891 CCTTTCAAATGGTGTGGAAAGGG No data
Right 1098728998 12:74008900-74008922 CTACAATCCTGGGCTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098728998 Original CRISPR CTACAATCCTGGGCTGAAGA TGG Intergenic
No off target data available for this crispr