ID: 1098731049

View in Genome Browser
Species Human (GRCh38)
Location 12:74037321-74037343
Sequence AGTTATCTGCAGAAGATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098731049_1098731053 16 Left 1098731049 12:74037321-74037343 CCTGCTATCTTCTGCAGATAACT No data
Right 1098731053 12:74037360-74037382 ACAGCTGTTGGCCTGTTACTGGG 0: 6
1: 191
2: 200
3: 162
4: 245
1098731049_1098731052 15 Left 1098731049 12:74037321-74037343 CCTGCTATCTTCTGCAGATAACT No data
Right 1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG No data
1098731049_1098731054 22 Left 1098731049 12:74037321-74037343 CCTGCTATCTTCTGCAGATAACT No data
Right 1098731054 12:74037366-74037388 GTTGGCCTGTTACTGGGCTTTGG 0: 5
1: 187
2: 172
3: 109
4: 201
1098731049_1098731050 4 Left 1098731049 12:74037321-74037343 CCTGCTATCTTCTGCAGATAACT No data
Right 1098731050 12:74037348-74037370 TCCTTTTGAGAGACAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098731049 Original CRISPR AGTTATCTGCAGAAGATAGC AGG (reversed) Intergenic
No off target data available for this crispr