ID: 1098731052

View in Genome Browser
Species Human (GRCh38)
Location 12:74037359-74037381
Sequence GACAGCTGTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098731048_1098731052 16 Left 1098731048 12:74037320-74037342 CCCTGCTATCTTCTGCAGATAAC No data
Right 1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG No data
1098731049_1098731052 15 Left 1098731049 12:74037321-74037343 CCTGCTATCTTCTGCAGATAACT No data
Right 1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098731052 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr