ID: 1098738066

View in Genome Browser
Species Human (GRCh38)
Location 12:74132737-74132759
Sequence CAAAAACAAAAATTGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39239
Summary {0: 277, 1: 2356, 2: 15287, 3: 12419, 4: 8900}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098738066_1098738068 21 Left 1098738066 12:74132737-74132759 CCATTTGTCAATTTTTGTTTTTG 0: 277
1: 2356
2: 15287
3: 12419
4: 8900
Right 1098738068 12:74132781-74132803 TAGCCATAAATTCCTTCCTGAGG No data
1098738066_1098738067 -5 Left 1098738066 12:74132737-74132759 CCATTTGTCAATTTTTGTTTTTG 0: 277
1: 2356
2: 15287
3: 12419
4: 8900
Right 1098738067 12:74132755-74132777 TTTTGTTGCATTTGCTTTTGAGG 0: 303
1: 1006
2: 1658
3: 2102
4: 3193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098738066 Original CRISPR CAAAAACAAAAATTGACAAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr