ID: 1098738067

View in Genome Browser
Species Human (GRCh38)
Location 12:74132755-74132777
Sequence TTTTGTTGCATTTGCTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8262
Summary {0: 303, 1: 1006, 2: 1658, 3: 2102, 4: 3193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098738066_1098738067 -5 Left 1098738066 12:74132737-74132759 CCATTTGTCAATTTTTGTTTTTG 0: 277
1: 2356
2: 15287
3: 12419
4: 8900
Right 1098738067 12:74132755-74132777 TTTTGTTGCATTTGCTTTTGAGG 0: 303
1: 1006
2: 1658
3: 2102
4: 3193
1098738065_1098738067 -4 Left 1098738065 12:74132736-74132758 CCCATTTGTCAATTTTTGTTTTT 0: 280
1: 2329
2: 15389
3: 12845
4: 10400
Right 1098738067 12:74132755-74132777 TTTTGTTGCATTTGCTTTTGAGG 0: 303
1: 1006
2: 1658
3: 2102
4: 3193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098738067 Original CRISPR TTTTGTTGCATTTGCTTTTG AGG Intergenic
Too many off-targets to display for this crispr