ID: 1098738068

View in Genome Browser
Species Human (GRCh38)
Location 12:74132781-74132803
Sequence TAGCCATAAATTCCTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098738066_1098738068 21 Left 1098738066 12:74132737-74132759 CCATTTGTCAATTTTTGTTTTTG 0: 277
1: 2356
2: 15287
3: 12419
4: 8900
Right 1098738068 12:74132781-74132803 TAGCCATAAATTCCTTCCTGAGG No data
1098738065_1098738068 22 Left 1098738065 12:74132736-74132758 CCCATTTGTCAATTTTTGTTTTT 0: 280
1: 2329
2: 15389
3: 12845
4: 10400
Right 1098738068 12:74132781-74132803 TAGCCATAAATTCCTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098738068 Original CRISPR TAGCCATAAATTCCTTCCTG AGG Intergenic
No off target data available for this crispr