ID: 1098741662

View in Genome Browser
Species Human (GRCh38)
Location 12:74179818-74179840
Sequence TGATACGGGCCATGAAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098741662_1098741666 18 Left 1098741662 12:74179818-74179840 CCTGAACTTCATGGCCCGTATCA No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data
1098741662_1098741665 -8 Left 1098741662 12:74179818-74179840 CCTGAACTTCATGGCCCGTATCA No data
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098741662 Original CRISPR TGATACGGGCCATGAAGTTC AGG (reversed) Intergenic
No off target data available for this crispr