ID: 1098741663

View in Genome Browser
Species Human (GRCh38)
Location 12:74179832-74179854
Sequence CAAAATGCTTACAGTGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098741663_1098741666 4 Left 1098741663 12:74179832-74179854 CCCGTATCACTGTAAGCATTTTG No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098741663 Original CRISPR CAAAATGCTTACAGTGATAC GGG (reversed) Intergenic