ID: 1098741665

View in Genome Browser
Species Human (GRCh38)
Location 12:74179833-74179855
Sequence CCGTATCACTGTAAGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098741662_1098741665 -8 Left 1098741662 12:74179818-74179840 CCTGAACTTCATGGCCCGTATCA No data
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741655_1098741665 30 Left 1098741655 12:74179780-74179802 CCCAAGAAGTTCCTCATCTCCAT 0: 109
1: 1457
2: 2009
3: 1648
4: 1176
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741659_1098741665 1 Left 1098741659 12:74179809-74179831 CCACCTCAGCCTGAACTTCATGG No data
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741656_1098741665 29 Left 1098741656 12:74179781-74179803 CCAAGAAGTTCCTCATCTCCATC 0: 110
1: 1467
2: 2149
3: 1703
4: 1241
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741661_1098741665 -2 Left 1098741661 12:74179812-74179834 CCTCAGCCTGAACTTCATGGCCC No data
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741658_1098741665 11 Left 1098741658 12:74179799-74179821 CCATCTGAGACCACCTCAGCCTG 0: 1460
1: 2022
2: 1492
3: 936
4: 848
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
1098741657_1098741665 19 Left 1098741657 12:74179791-74179813 CCTCATCTCCATCTGAGACCACC 0: 1210
1: 1751
2: 1410
3: 900
4: 852
Right 1098741665 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098741665 Original CRISPR CCGTATCACTGTAAGCATTT TGG Intergenic
No off target data available for this crispr