ID: 1098741666

View in Genome Browser
Species Human (GRCh38)
Location 12:74179859-74179881
Sequence ACGCCATTCAACAAGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098741663_1098741666 4 Left 1098741663 12:74179832-74179854 CCCGTATCACTGTAAGCATTTTG No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data
1098741659_1098741666 27 Left 1098741659 12:74179809-74179831 CCACCTCAGCCTGAACTTCATGG No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data
1098741661_1098741666 24 Left 1098741661 12:74179812-74179834 CCTCAGCCTGAACTTCATGGCCC No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data
1098741664_1098741666 3 Left 1098741664 12:74179833-74179855 CCGTATCACTGTAAGCATTTTGG No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data
1098741662_1098741666 18 Left 1098741662 12:74179818-74179840 CCTGAACTTCATGGCCCGTATCA No data
Right 1098741666 12:74179859-74179881 ACGCCATTCAACAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098741666 Original CRISPR ACGCCATTCAACAAGTCTCC AGG Intergenic
No off target data available for this crispr