ID: 1098748633

View in Genome Browser
Species Human (GRCh38)
Location 12:74269029-74269051
Sequence GCTCCATGCACTTGGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748633_1098748643 13 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG No data
1098748633_1098748640 10 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748633_1098748638 -6 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748638 12:74269046-74269068 TGGAGCATTATATAAGGAAAAGG 0: 10
1: 14
2: 10
3: 35
4: 253
1098748633_1098748641 11 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748633_1098748639 -5 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613
1098748633_1098748642 12 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748642 12:74269064-74269086 AAAGGGCCTGTTAAACTCTGGGG No data
1098748633_1098748645 18 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748645 12:74269070-74269092 CCTGTTAAACTCTGGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748633 Original CRISPR GCTCCATGCACTTGGAGGGT TGG (reversed) Intergenic
No off target data available for this crispr