ID: 1098748634

View in Genome Browser
Species Human (GRCh38)
Location 12:74269033-74269055
Sequence TAATGCTCCATGCACTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 11, 1: 17, 2: 29, 3: 36, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748634_1098748645 14 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748645 12:74269070-74269092 CCTGTTAAACTCTGGGGGAAAGG No data
1098748634_1098748642 8 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748642 12:74269064-74269086 AAAGGGCCTGTTAAACTCTGGGG No data
1098748634_1098748638 -10 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748638 12:74269046-74269068 TGGAGCATTATATAAGGAAAAGG 0: 10
1: 14
2: 10
3: 35
4: 253
1098748634_1098748640 6 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748634_1098748641 7 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748634_1098748643 9 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG No data
1098748634_1098748639 -9 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748634 Original CRISPR TAATGCTCCATGCACTTGGA GGG (reversed) Intergenic
902986621 1:20158422-20158444 TAATGCCCCATGCACTTGGAGGG - Intergenic
905061626 1:35144799-35144821 TAATTTTTCATGCACTTAGAGGG + Intergenic
911973364 1:104463758-104463780 TAATGCCCCATGCACTTGGAGGG + Intergenic
916102978 1:161408715-161408737 TAATTTTTCATGCACTTGGAGGG + Intergenic
917156506 1:172005529-172005551 TAAGGCTCCTTGCACATTGATGG + Intronic
918137790 1:181690598-181690620 AAATATTCCATGCTCTTGGATGG - Intronic
918647198 1:186918378-186918400 TAATGCTCCATGCACTTGGAGGG + Intronic
1062903997 10:1167204-1167226 TTAAGCTCCTTTCACTTGGAAGG - Intergenic
1064397229 10:14991700-14991722 TCACGCTACATGCACTTGAAGGG + Intergenic
1064400127 10:15014170-15014192 TCACGCTCCATGCACTTGAAGGG + Intergenic
1066390395 10:34973459-34973481 TCATGTTCCATGCACTTGAAGGG - Intergenic
1066551924 10:36568186-36568208 TAAAGATACATGCACGTGGATGG - Intergenic
1066649819 10:37643529-37643551 TTATGTTCCATCCACTGGGATGG + Intergenic
1068966469 10:62916900-62916922 TAATGCTGCAGGCACTAGAATGG + Intronic
1071282215 10:84113174-84113196 TAATGCTGCATGCACTTGGAGGG - Intergenic
1071972093 10:90918130-90918152 TAATGCTACATGAACAAGGAAGG - Intronic
1072502562 10:96032745-96032767 TACAGCTCCATGTATTTGGAAGG + Intergenic
1076228366 10:128799406-128799428 TAAAGCTCCTTGCACATGGAGGG + Intergenic
1077589041 11:3477553-3477575 TAATGCTCCACGCACTTGAAGGG + Intergenic
1080890396 11:36404133-36404155 TGGTGCTCTATGCACATGGATGG - Intronic
1081911450 11:46702481-46702503 TAATTCTCCATACCCTTGGGAGG + Intronic
1084227718 11:67727679-67727701 TCATGGTCCATGCACTTGAAGGG + Intergenic
1084244736 11:67849176-67849198 TAATGCTCCACGCACTTGAAGGG + Intergenic
1084811524 11:71614729-71614751 TCACGCTCCATGCACGTGAAGGG - Intergenic
1084827950 11:71745380-71745402 TAATGCTCCACGCACCTGAAGGG - Intergenic
1084844606 11:71889193-71889215 TCACGCTCCATGAACTTGAAGGG - Intronic
1084847457 11:71911651-71911673 TCACGCTCCATGCACTTGAAGGG - Intronic
1085263633 11:75223680-75223702 GAATCCTCCTTGCACTTGGAAGG - Intergenic
1086055486 11:82641584-82641606 TAATTCTCCATGGACTTGTCTGG - Intergenic
1086114751 11:83236857-83236879 GAATGCTACAGGCATTTGGATGG - Intronic
1087789467 11:102391529-102391551 TAAATCTCCATGCTCCTGGATGG + Intergenic
1091039312 11:132262023-132262045 GAATGCTCATTGCACTTGGCTGG - Intronic
1092415300 12:8286321-8286343 TAATGCTCCACGCACTTGAAGGG + Intergenic
1092432384 12:8419922-8419944 TCACGCTCCATGCACTTGAAGGG + Intergenic
1092975024 12:13736408-13736430 TAATGTTCCTTGCACTTGACAGG - Intronic
1093289290 12:17301584-17301606 TAATGCCCCATGCACTTGGAGGG - Intergenic
1096318614 12:50591239-50591261 TACTTCTCCATGGACTTTGAAGG + Intronic
1096509013 12:52116888-52116910 TAATGCTCCATGCACTTGAAGGG + Intergenic
1098748634 12:74269033-74269055 TAATGCTCCATGCACTTGGAGGG - Intergenic
1101029257 12:100643900-100643922 TAATGCTCCACGAACTTGGAGGG + Intergenic
1101068067 12:101043799-101043821 TAATTGTCCATGTATTTGGAAGG + Intronic
1103048817 12:117761371-117761393 TAGTGCTGGACGCACTTGGACGG + Exonic
1104292903 12:127485552-127485574 TAATGCCCCATGCATTTGGAGGG - Intergenic
1107490510 13:40876656-40876678 TAATGCTCCATGCACTTGGAGGG + Intergenic
1107544164 13:41421488-41421510 TCACGCTCCATGCACTTGAAGGG + Intergenic
1109802994 13:67401897-67401919 TAATGCTCCATGCACTTGGAGGG - Intergenic
1112191252 13:97179952-97179974 TCATGCTCTATGCAATTGAACGG - Intergenic
1114883232 14:26813045-26813067 TAATTCTGCATGACCTTGGATGG + Intergenic
1120991548 14:90382163-90382185 TAATGCTCCATACACTTAAGGGG + Intergenic
1124356158 15:28996381-28996403 TACTGCTCCATGCACAGGGAGGG - Intronic
1126164898 15:45646503-45646525 TAAAGCTCTATGCACATGGGAGG + Intronic
1127096313 15:55515121-55515143 TAATGCTCCACGCACTTGGAGGG + Intergenic
1127395377 15:58540516-58540538 AGATGCTCCATGCACATAGAAGG + Intronic
1134813139 16:17184218-17184240 AAATGCTCAATGCACTGGGCAGG + Intronic
1135487562 16:22879443-22879465 TTCTGCACCATGCCCTTGGAAGG + Intronic
1145864851 17:28234528-28234550 TAATGCTCCATGCACTTGAAGGG + Intergenic
1146448838 17:32955463-32955485 TAAAGCTGCATGAACTTGGGAGG + Intergenic
1149203859 17:54220250-54220272 CAATCCTCCCTGCACTTGGTTGG - Intergenic
1153100834 18:1467602-1467624 TCATGATCCTTGCACTTAGAAGG - Intergenic
1153190655 18:2534267-2534289 TATGGCTCCAGGGACTTGGATGG + Intergenic
1155329730 18:24702946-24702968 CCATGCTCCAGGCTCTTGGAAGG + Intergenic
1158251792 18:55497835-55497857 TAAAGCTACATGAAATTGGAAGG + Intronic
1159832222 18:73291012-73291034 TTATGTTCCAAGCACTTTGAAGG + Intergenic
1160875778 19:1295648-1295670 TAGTGCTCCATGCGCTCGGCCGG - Exonic
1161591831 19:5132518-5132540 TCATCCTGCATGCAATTGGAGGG + Intronic
1162044474 19:7989264-7989286 TAAAGCTCCAGTCACTTGAAGGG + Intronic
1162284214 19:9726149-9726171 CCACACTCCATGCACTTGGAGGG + Intergenic
1163536684 19:17880962-17880984 TAATGCTCCATGAACAAGCAGGG - Intronic
1163916783 19:20247067-20247089 TAATGCTTTATGCACTTGGAGGG - Intergenic
1163943217 19:20513856-20513878 TAATGCTCCATGCACTTGGAGGG + Intergenic
1163966379 19:20750848-20750870 TAATGCTCCATGCACTTGAAGGG + Intronic
1164626627 19:29733108-29733130 TAAAGCTTCATGCACTTTTATGG + Intergenic
1167942598 19:52959661-52959683 TAATGCTTTATGCACTTGAAGGG - Intronic
925995776 2:9291858-9291880 TAATGGTACATGCACTTGACTGG + Intronic
926771921 2:16385817-16385839 TTATGCTCCAGGCACTCGGCTGG + Intergenic
931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG + Intergenic
931972575 2:67605316-67605338 AAATGCTCCATGCAAATTGATGG + Intergenic
932353434 2:71049713-71049735 TAATCCTCTACGCACTTGAAGGG - Intergenic
933731353 2:85458647-85458669 TGATGCTCACTGCACCTGGATGG - Intergenic
938115668 2:128601696-128601718 AAATGATCCTGGCACTTGGAGGG + Intergenic
940869519 2:158848352-158848374 TCACGCTCCATGCACTTGAAGGG - Intronic
940872195 2:158869350-158869372 TCACGCTCCATGCACTTGAAGGG - Intergenic
940874402 2:158885338-158885360 TCATGCTCCATGCACTTGAAGGG - Intergenic
941193586 2:162418272-162418294 TAATCCTCCATGCATTTAAAAGG - Intronic
944657465 2:201890423-201890445 TTGTGCTCCATAGACTTGGAGGG + Intronic
947594996 2:231405496-231405518 TGATGCTTCATGCACTTGAAGGG - Intergenic
1170870621 20:20202772-20202794 TAAAGCTTGATGCACTGGGAGGG - Intronic
1171408540 20:24930214-24930236 TAACGCTCCATGCACTTGAAGGG - Intergenic
1176307767 21:5133143-5133165 GAATCCTCCAGGCTCTTGGAGGG - Intronic
1177809792 21:25914013-25914035 TCCTGATCCATGCACTTGGTAGG + Intronic
1178447708 21:32660761-32660783 TAATGCTCCATGCACTTGGAGGG - Intronic
1178459765 21:32792352-32792374 TAAGGCTCAATCCATTTGGAAGG - Exonic
1179849293 21:44128887-44128909 GAATCCTCCAGGCTCTTGGAGGG + Intronic
949158112 3:851123-851145 CAATGCCCCATGCACTTGCAGGG - Intergenic
949884558 3:8682936-8682958 TCACGCTCCATGCACTTGAAGGG - Intronic
951720836 3:25696088-25696110 TAAAGCTCTATGCACATGAAAGG + Intergenic
957044395 3:75362744-75362766 TCATGCTCCATGCACTTGAAGGG + Intergenic
957076191 3:75604927-75604949 TCATGCTCCATGCACTTGAAGGG + Intergenic
960311577 3:116122896-116122918 TGATGCTCCCTGCCCTTAGAAGG + Intronic
961272245 3:125698022-125698044 TCACGCTCCATGCACTTGAAGGG - Intergenic
961275108 3:125720255-125720277 TCATGCTCCATGCACTTGAAGGG - Intergenic
961876389 3:130026778-130026800 TCATGCTCCATGCACTTGAAGGG + Intergenic
961892850 3:130144935-130144957 TAATGCTCCACGCACTTGAAGGG + Intergenic
964522404 3:157583223-157583245 TAATGCTCCATGCACTTGGAGGG + Intronic
964951206 3:162295826-162295848 TAATCCTGCATTCACTAGGAAGG - Intergenic
965589964 3:170353538-170353560 TTAGGCTCCATGCAACTGGAAGG - Intergenic
968988660 4:3893984-3894006 TCACACTCCATGCACTTGAAGGG + Intergenic
969019640 4:4131227-4131249 TCATGCTCCATGCACTTGAACGG + Intergenic
969024345 4:4161627-4161649 TCACACTCCATGCACTTGAAGGG + Intergenic
969025250 4:4167573-4167595 TCATGCTCCATGCACTTGAAGGG + Intergenic
969646974 4:8436443-8436465 TAATTCTCCATGCAGTTGGAGGG - Intronic
969729472 4:8945538-8945560 TCACGCTCCATGCACTTGAAGGG - Intergenic
969749913 4:9102206-9102228 TAATGTTCCATGCACTAGAAGGG - Intergenic
969789061 4:9479477-9479499 TCATGCTCCATGCACTTGAAAGG - Intergenic
969793797 4:9510245-9510267 TCACGCTCCATGTACTTGAAGGG - Intergenic
970787957 4:19822333-19822355 TAATGCAGTATGAACTTGGATGG - Intergenic
972077467 4:35105220-35105242 TAATGCCCCATGTACTTGAAGGG - Intergenic
973234596 4:47885882-47885904 CATTGCTCCTTGCACTTGGGTGG + Exonic
976970031 4:91093025-91093047 TAATGCTCCATATACTTGAATGG + Intronic
980780142 4:137483031-137483053 TAATGCTCCATGCACTTGGAGGG - Intergenic
981718801 4:147778443-147778465 TAATGCTCTGTGCCCTTGGCAGG - Intronic
982411912 4:155087092-155087114 TAATGCCCCATGTATATGGAGGG + Intergenic
988454002 5:31371421-31371443 TTATTCTCCATGCATTTGGGTGG - Intergenic
995473825 5:112528627-112528649 TAATGCTCCATGCACTTGGAGGG - Intergenic
998201633 5:140129138-140129160 TCATGCTCCATTCTCATGGAAGG + Exonic
1002408138 5:179052452-179052474 TAATGCTCCGTGCACTTGGAGGG + Intergenic
1004250448 6:14019110-14019132 TAATTCTACACGCAGTTGGATGG + Intergenic
1004903412 6:20213509-20213531 TAATGCTCAGTGCAGTTTGATGG - Intergenic
1008320800 6:50111181-50111203 TATTGCTCCATGCCCTGGTAAGG + Intergenic
1008583081 6:52923722-52923744 TAATTCTCCATGCACTTGGAGGG - Intergenic
1009475165 6:64081731-64081753 TAATGCTTCATGCACTGGTCTGG + Intronic
1010547660 6:77177675-77177697 TAATGTTCCACACACTGGGATGG - Intergenic
1011565344 6:88666912-88666934 TAATGCCCCATGCACTTGGAGGG - Intronic
1012214362 6:96563201-96563223 AAAAGCTGCATGCAGTTGGAAGG + Exonic
1012611696 6:101227165-101227187 TAACACCCCATGCACTTGGAGGG + Intergenic
1015954818 6:138588554-138588576 TCAAGCTCCATGCTGTTGGAGGG - Intronic
1017941204 6:159054879-159054901 TAAAGCTCCATGCACCTTGTGGG - Intergenic
1020307028 7:6843254-6843276 GCATGCTCCATGCACTTAAAGGG + Intergenic
1020311504 7:6872098-6872120 TCACGCTCCATGCACTTGAAGGG + Intergenic
1020323072 7:6954436-6954458 TAATGCTCCATGCACTAGAAGGG + Intergenic
1020646610 7:10821764-10821786 TAAAGCTCAATGAAATTGGAAGG + Intergenic
1022780283 7:33575185-33575207 TGATGCTGCATGCTCTTGGCTGG + Intronic
1027611965 7:80372818-80372840 TAATCTTTCATGCACTGGGAAGG - Intronic
1028915144 7:96250875-96250897 TAATGTTCCATGCACATGTGAGG - Intronic
1029078182 7:97952198-97952220 GCATGCTCCATGCACTTGAAGGG + Intergenic
1032170769 7:129582811-129582833 TAATGCACCATGTACTTAGAGGG - Intergenic
1032245636 7:130209288-130209310 TAATGCTCTATGAGCTCGGATGG + Intronic
1032256873 7:130304581-130304603 TGAGGCCACATGCACTTGGAAGG + Intronic
1032884733 7:136125054-136125076 TAATCATCCTTGCTCTTGGAGGG - Intergenic
1036239827 8:7072305-7072327 GAATGCTCCATGCACTTGAAAGG - Intergenic
1036262051 8:7248849-7248871 TCACACTCCATGCACTTGAAGGG + Intergenic
1036304540 8:7590709-7590731 TCACACTCCATGCACTTGAAGGG - Intergenic
1036314090 8:7707388-7707410 TCACACTCCATGCACTTGAAGGG + Intergenic
1036355393 8:8038701-8038723 TCACACTCCATGCACTTGAAGGG - Intergenic
1036372992 8:8176546-8176568 TAATGTTCCATGCATTTGAAGGG - Intergenic
1036816613 8:11907313-11907335 TCACGCTCCATGCACTTGAAGGG + Intergenic
1036833342 8:12038841-12038863 TCACGCTCCATGCACTTGAAGGG + Intergenic
1036855188 8:12285406-12285428 TCACGCTCCATGCACTTGAAGGG + Intergenic
1036877913 8:12489095-12489117 TAATGTTCCATGCATTTGAAGGG + Intergenic
1036903507 8:12689260-12689282 TCACGCTCCATGCACTTGAAGGG + Intergenic
1036906006 8:12708939-12708961 TCATGCTCCATGCACTTGAAGGG + Intergenic
1036994370 8:13638235-13638257 TTATGCTCTCTGCACTAGGATGG - Intergenic
1037909839 8:22737872-22737894 TAATGACCCTTACACTTGGACGG - Intronic
1038471894 8:27831090-27831112 GAATGTTGCATGCACTTGAAAGG + Intronic
1038799121 8:30733354-30733376 TAATGCTCCATGCACTTGAAGGG - Intronic
1040467379 8:47707736-47707758 AAATGCATCATGGACTTGGAAGG - Intronic
1041008996 8:53523261-53523283 TAATGCTCCATGCACTTGGAGGG + Intergenic
1041030929 8:53734549-53734571 TAATGCCCCATGTACTTGGAGGG - Intronic
1041207491 8:55513124-55513146 TCATGCTTCGTGGACTTGGAAGG - Intronic
1050653558 9:7799482-7799504 TAATGGTCCATGGACTCGGGGGG + Exonic
1054931365 9:70638943-70638965 GAATGAACCATGCATTTGGACGG + Intronic
1055831813 9:80388455-80388477 TAATGCCCCAAGCACTTTAATGG + Intergenic
1056865842 9:90226809-90226831 TCACGCTCCATGCACTTGAAGGG - Intergenic
1056917176 9:90756094-90756116 TCATGCTCCATGCACTTGAAGGG + Intergenic
1059581930 9:115558621-115558643 AAATGTTCCAGGCACTTTGAAGG + Intergenic
1062224089 9:135439246-135439268 TAATGCACCATGCACTTGAAGGG + Intergenic
1062344939 9:136110272-136110294 TGATGCTCCGTGATCTTGGAAGG - Intergenic
1185909959 X:3972164-3972186 TAATGCTCCATGCACTTGGAGGG - Intergenic
1189134901 X:38538452-38538474 TAATGTTTCATGGCCTTGGAAGG - Intronic
1189306629 X:39991727-39991749 TTATGCTCTATGCTCTTGAAGGG - Intergenic
1190425848 X:50333969-50333991 TAATGTTCCATGCACTTGGAGGG + Intronic
1191036038 X:56027461-56027483 TAATGCCCCATGTACTTGAAGGG + Intergenic
1192732921 X:73819202-73819224 TAAAGGTCCATGTACTGGGACGG + Intergenic
1193070211 X:77298573-77298595 GAGTGCTCCATGCACTTGGAGGG - Intergenic
1193536582 X:82723964-82723986 TAATGCTTCATGAACTAGGAAGG - Intergenic
1194400548 X:93434437-93434459 TAATGCTCCATGCACTTGAAGGG - Intergenic
1196153873 X:112406005-112406027 AAATGCTCCCTCCACATGGAGGG - Intergenic
1197035532 X:121869956-121869978 TCATGCCCCACCCACTTGGAAGG - Intergenic
1198469644 X:136934404-136934426 TAATTATCCATGCACTTGGAGGG + Intergenic
1198970067 X:142269919-142269941 TAATGCTCCGTGTACTTGAAGGG - Intergenic
1199561295 X:149165740-149165762 AAATGCTCCATGTTCATGGATGG + Intergenic
1200925300 Y:8648954-8648976 TAATGCTCCATGCGCTTGGAGGG - Intergenic
1200943378 Y:8807712-8807734 TAATGCTCTATGCACATGGAGGG - Intergenic
1200983610 Y:9284477-9284499 TAATGCTCCATGTACTTGGAGGG + Intergenic
1201270351 Y:12247977-12247999 TAATGCTCCATGTACTTGAATGG - Intergenic
1201461117 Y:14225449-14225471 TTATGCTCTATGCAAATGGATGG + Intergenic
1201680515 Y:16640088-16640110 TAATGCTCCATGTACTTGAAGGG + Intergenic
1201696926 Y:16836230-16836252 CAATGCTCCACGTACTTGAAGGG - Intergenic
1201947586 Y:19527987-19528009 TACTACTGCATGCACTTAGAAGG + Intergenic
1202126758 Y:21575211-21575233 TAATGCTCCATGTACTTGGAGGG - Intergenic