ID: 1098748635

View in Genome Browser
Species Human (GRCh38)
Location 12:74269034-74269056
Sequence ATAATGCTCCATGCACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 11, 1: 19, 2: 26, 3: 38, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748635_1098748643 8 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG No data
1098748635_1098748639 -10 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613
1098748635_1098748642 7 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748642 12:74269064-74269086 AAAGGGCCTGTTAAACTCTGGGG No data
1098748635_1098748645 13 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748645 12:74269070-74269092 CCTGTTAAACTCTGGGGGAAAGG No data
1098748635_1098748641 6 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748635_1098748640 5 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748635 Original CRISPR ATAATGCTCCATGCACTTGG AGG (reversed) Intergenic
902986622 1:20158423-20158445 ATAATGCCCCATGCACTTGGAGG - Intergenic
905061625 1:35144798-35144820 ATAATTTTTCATGCACTTAGAGG + Intergenic
905646769 1:39630232-39630254 AAAATGCTCCATGCCACTGGTGG - Exonic
905746815 1:40425200-40425222 AAAATGTTCCATGCTCTTGTAGG - Intergenic
906693447 1:47808578-47808600 ACAATGCTCCATGTAATTGGGGG - Intronic
909996115 1:82281587-82281609 ATAGTACTCCATGCACTGTGTGG - Intergenic
910107832 1:83650751-83650773 ATAATGCTACCTTCTCTTGGGGG - Intergenic
911127421 1:94353483-94353505 ATTATGCTAAATTCACTTGGTGG - Intergenic
911973363 1:104463757-104463779 ATAATGCCCCATGCACTTGGAGG + Intergenic
916102977 1:161408714-161408736 ATAATTTTTCATGCACTTGGAGG + Intergenic
918647197 1:186918377-186918399 ATAATGCTCCATGCACTTGGAGG + Intronic
918830142 1:189385385-189385407 AGATTGCTACATTCACTTGGGGG - Intergenic
919765104 1:201122093-201122115 ATGATGCTTCATGCTCTGGGTGG + Intronic
923204623 1:231746393-231746415 ATAATGCTGCAAGAACATGGGGG + Intronic
923245692 1:232129997-232130019 ATAATTCTCTATGCACTTCTAGG + Intergenic
1064397228 10:14991699-14991721 ATCACGCTACATGCACTTGAAGG + Intergenic
1064400126 10:15014169-15014191 ATCACGCTCCATGCACTTGAAGG + Intergenic
1065972158 10:30814113-30814135 ATAATACCCCATGCACTTGGAGG + Intergenic
1066390396 10:34973460-34973482 ATCATGTTCCATGCACTTGAAGG - Intergenic
1070485307 10:76924861-76924883 ACAATGCCCCATGCACATAGGGG + Intronic
1071282216 10:84113175-84113197 ATAATGCTGCATGCACTTGGAGG - Intergenic
1073357811 10:102870818-102870840 AGAAGGCTCCATGCAGTAGGTGG - Intronic
1074273666 10:111980317-111980339 ATAATGTTCAATGAACATGGGGG + Intergenic
1074608299 10:114996081-114996103 CTAATACTTCATGCATTTGGGGG - Intergenic
1075918273 10:126188493-126188515 ATTATGCCTCATGCATTTGGTGG + Intronic
1076228365 10:128799405-128799427 TTAAAGCTCCTTGCACATGGAGG + Intergenic
1076310520 10:129503217-129503239 ATATTGTGCAATGCACTTGGGGG + Intronic
1077589040 11:3477552-3477574 ATAATGCTCCACGCACTTGAAGG + Intergenic
1078082491 11:8214431-8214453 ATAATGCTCATTGCAAGTGGAGG - Intergenic
1078438014 11:11341319-11341341 TGAATTCTCCTTGCACTTGGGGG + Intronic
1081145323 11:39556379-39556401 ATAATGCTCAATGAACATAGGGG - Intergenic
1083373530 11:62201486-62201508 AGGCTGCTCCATGCACCTGGAGG - Intergenic
1083379136 11:62250522-62250544 AGGCTGCTCCATGCACCTGGAGG - Intergenic
1083808629 11:65089680-65089702 AAAATGCTCCAAGCACCTGAAGG - Intronic
1084227717 11:67727678-67727700 ATCATGGTCCATGCACTTGAAGG + Intergenic
1084244735 11:67849175-67849197 ATAATGCTCCACGCACTTGAAGG + Intergenic
1084811525 11:71614730-71614752 ATCACGCTCCATGCACGTGAAGG - Intergenic
1084827951 11:71745381-71745403 ATAATGCTCCACGCACCTGAAGG - Intergenic
1084844607 11:71889194-71889216 ATCACGCTCCATGAACTTGAAGG - Intronic
1084847458 11:71911652-71911674 ATCACGCTCCATGCACTTGAAGG - Intronic
1085428777 11:76428302-76428324 ATAATTCTCCAAGCACAAGGGGG - Intergenic
1088734171 11:112712882-112712904 TCACTGCTCCATGCACTTAGAGG + Intergenic
1089980602 11:122768967-122768989 AGAAACCTCCATGCACCTGGTGG - Intronic
1090692399 11:129197690-129197712 ATTGTGCTCCATACATTTGGAGG - Intronic
1092415299 12:8286320-8286342 ATAATGCTCCACGCACTTGAAGG + Intergenic
1092432383 12:8419921-8419943 ATCACGCTCCATGCACTTGAAGG + Intergenic
1093289291 12:17301585-17301607 ATAATGCCCCATGCACTTGGAGG - Intergenic
1096509012 12:52116887-52116909 ATAATGCTCCATGCACTTGAAGG + Intergenic
1098748635 12:74269034-74269056 ATAATGCTCCATGCACTTGGAGG - Intergenic
1101029256 12:100643899-100643921 ATAATGCTCCACGAACTTGGAGG + Intergenic
1101196779 12:102391728-102391750 AGAATGCTGCTTGCACTGGGAGG + Intergenic
1104292904 12:127485553-127485575 ATAATGCCCCATGCATTTGGAGG - Intergenic
1107490509 13:40876655-40876677 ATAATGCTCCATGCACTTGGAGG + Intergenic
1107544163 13:41421487-41421509 ATCACGCTCCATGCACTTGAAGG + Intergenic
1109802995 13:67401898-67401920 ATAATGCTCCATGCACTTGGAGG - Intergenic
1112377820 13:98860382-98860404 GTAACGCTCCATGCTCTTGTGGG - Intronic
1120445451 14:84589289-84589311 AAAATGCTACATGCTCTTTGGGG + Intergenic
1120991547 14:90382162-90382184 CTAATGCTCCATACACTTAAGGG + Intergenic
1123930531 15:25169420-25169442 ATAATGGTCCATGGACCCGGGGG + Intergenic
1123995381 15:25714314-25714336 AGGATGCTCCAGGCACTTGGAGG + Intronic
1124356159 15:28996382-28996404 ATACTGCTCCATGCACAGGGAGG - Intronic
1127096312 15:55515120-55515142 ATAATGCTCCACGCACTTGGAGG + Intergenic
1143446009 17:7009978-7010000 CTAATGCTCCATGCACAATGCGG + Exonic
1144487608 17:15680282-15680304 AAAATGCTGTATGGACTTGGAGG - Intronic
1145864850 17:28234527-28234549 ATAATGCTCCATGCACTTGAAGG + Intergenic
1146796657 17:35785986-35786008 ATAAAGCTCCATGAACATAGAGG - Intronic
1149355712 17:55837224-55837246 ATAATGCTGCAAGCAGTGGGTGG + Intronic
1157048511 18:44132336-44132358 ATAGTGCTTCATGCACTCTGTGG + Intergenic
1163536685 19:17880963-17880985 ATAATGCTCCATGAACAAGCAGG - Intronic
1163916784 19:20247068-20247090 ATAATGCTTTATGCACTTGGAGG - Intergenic
1163943216 19:20513855-20513877 ATAATGCTCCATGCACTTGGAGG + Intergenic
1163966378 19:20750847-20750869 ATAATGCTCCATGCACTTGAAGG + Intronic
1167942599 19:52959662-52959684 ATAATGCTTTATGCACTTGAAGG - Intronic
931698386 2:64889246-64889268 ATAAAGCCCCATGCACTTGGAGG + Intergenic
932030874 2:68183245-68183267 AAAATGCTCCATGTTCTTGTGGG + Intronic
932250880 2:70242657-70242679 ATAATGGTCCATGGCCTAGGGGG - Intronic
932349940 2:71023576-71023598 ATCACGCTCCATGCACTTGAAGG - Intergenic
932353435 2:71049714-71049736 ATAATCCTCTACGCACTTGAAGG - Intergenic
938115667 2:128601695-128601717 AAAATGATCCTGGCACTTGGAGG + Intergenic
938669380 2:133572489-133572511 TAAATTCTCCATGCCCTTGGAGG + Intergenic
940869520 2:158848353-158848375 ATCACGCTCCATGCACTTGAAGG - Intronic
940872196 2:158869351-158869373 ATCACGCTCCATGCACTTGAAGG - Intergenic
940874403 2:158885339-158885361 ATCATGCTCCATGCACTTGAAGG - Intergenic
941508684 2:166378133-166378155 AAAATGCTCCAGCCACTTTGAGG - Intergenic
943119775 2:183721022-183721044 ATAATGCTGAATGGACATGGTGG - Intergenic
943594091 2:189834457-189834479 ATAATTCTCATTGCAGTTGGAGG + Intronic
947594997 2:231405497-231405519 ATGATGCTTCATGCACTTGAAGG - Intergenic
948742254 2:240055708-240055730 ATCATGCTCCCTCCTCTTGGAGG - Intergenic
949014544 2:241702073-241702095 ATAGTGCTCCAAGTACATGGCGG - Exonic
1170870622 20:20202773-20202795 ATAAAGCTTGATGCACTGGGAGG - Intronic
1171408541 20:24930215-24930237 ATAACGCTCCATGCACTTGAAGG - Intergenic
1178447709 21:32660762-32660784 ATAATGCTCCATGCACTTGGAGG - Intronic
949158113 3:851124-851146 ACAATGCCCCATGCACTTGCAGG - Intergenic
949884559 3:8682937-8682959 ATCACGCTCCATGCACTTGAAGG - Intronic
950948534 3:16975775-16975797 ATTATGCCCCATGCACTCAGAGG - Intronic
950968978 3:17167672-17167694 ATGGTGCTCCATGCCCTGGGGGG + Intronic
952057695 3:29468961-29468983 ATAATTCACCATGCTTTTGGAGG - Intronic
952759637 3:36902826-36902848 ATTGTGCTCCATCCACTAGGAGG + Intronic
953292154 3:41676151-41676173 ATAAATCACCATGAACTTGGTGG - Intronic
955683951 3:61531285-61531307 TAAATGCTTCATGCACTTGAAGG - Intergenic
957044394 3:75362743-75362765 ATCATGCTCCATGCACTTGAAGG + Intergenic
957076190 3:75604926-75604948 ATCATGCTCCATGCACTTGAAGG + Intergenic
961272246 3:125698023-125698045 ATCACGCTCCATGCACTTGAAGG - Intergenic
961275109 3:125720256-125720278 ATCATGCTCCATGCACTTGAAGG - Intergenic
961318036 3:126053995-126054017 ATAATGATTCTTGCACTTGAGGG + Intronic
961876388 3:130026777-130026799 ATCATGCTCCATGCACTTGAAGG + Intergenic
961892849 3:130144934-130144956 ATAATGCTCCACGCACTTGAAGG + Intergenic
964517457 3:157528058-157528080 TTAATTTTTCATGCACTTGGGGG + Intronic
964522403 3:157583222-157583244 ATAATGCTCCATGCACTTGGAGG + Intronic
965616008 3:170593187-170593209 ATAATACATTATGCACTTGGTGG - Intronic
968988659 4:3893983-3894005 ATCACACTCCATGCACTTGAAGG + Intergenic
969024344 4:4161626-4161648 ATCACACTCCATGCACTTGAAGG + Intergenic
969025249 4:4167572-4167594 ATCATGCTCCATGCACTTGAAGG + Intergenic
969646975 4:8436444-8436466 ATAATTCTCCATGCAGTTGGAGG - Intronic
969729473 4:8945539-8945561 ATCACGCTCCATGCACTTGAAGG - Intergenic
969734211 4:8976182-8976204 ATCACGCTCCATGCACTAGAAGG - Intergenic
969749914 4:9102207-9102229 ATAATGTTCCATGCACTAGAAGG - Intergenic
969793798 4:9510246-9510268 ATCACGCTCCATGTACTTGAAGG - Intergenic
972077468 4:35105221-35105243 ATAATGCCCCATGTACTTGAAGG - Intergenic
972387667 4:38583582-38583604 ATAATGCAACATGCACTTAAGGG - Intergenic
973104088 4:46310218-46310240 TGAATGCCCAATGCACTTGGAGG - Exonic
976634177 4:87271109-87271131 ATTTTGCTCCCTGCAGTTGGAGG + Intergenic
980780143 4:137483032-137483054 ATAATGCTCCATGCACTTGGAGG - Intergenic
982474452 4:155833212-155833234 ATATTGATCCATTCATTTGGTGG - Intronic
983545207 4:168956235-168956257 ATAATGCTTCCAGCACTGGGAGG + Intronic
984867588 4:184295230-184295252 ATTGTGATACATGCACTTGGAGG + Intergenic
990349353 5:54900143-54900165 ATAAGGCCCCATGGACTGGGTGG - Intergenic
993186151 5:84622721-84622743 ATTATGCTCCCTTCACATGGAGG + Intergenic
994023814 5:95059101-95059123 ATAATGATATATGCACTTGTAGG + Intronic
995473826 5:112528628-112528650 ATAATGCTCCATGCACTTGGAGG - Intergenic
997053704 5:130414128-130414150 ATAATTTTCCATGGAGTTGGTGG - Intergenic
997056890 5:130453983-130454005 ATAATGCTACATGCTCCTTGTGG + Intergenic
997114115 5:131107572-131107594 ATAAATCTCCAACCACTTGGTGG - Intergenic
997814034 5:136999055-136999077 ATAAAGCTCCATGCCTTGGGTGG - Intronic
1000231558 5:159320225-159320247 ACAATGCCCCATGCACTGTGGGG - Intronic
1000988001 5:167881929-167881951 ATAATCCTTCATGCATTGGGAGG - Intronic
1001811677 5:174633659-174633681 ATTATATTCCATGCACTTTGTGG - Intergenic
1002408137 5:179052451-179052473 ATAATGCTCCGTGCACTTGGAGG + Intergenic
1003523066 6:6875085-6875107 TTAGTCCTCCATGCCCTTGGTGG - Intergenic
1004419899 6:15459862-15459884 ATAGTGTTCCTTGCAATTGGGGG - Intronic
1007142809 6:39592888-39592910 ATAATGCTGCATGGAATTTGTGG + Intronic
1008583082 6:52923723-52923745 ATAATTCTCCATGCACTTGGAGG - Intergenic
1011405602 6:87012221-87012243 ATAATCCTCCAGAGACTTGGGGG + Intronic
1011565345 6:88666913-88666935 ATAATGCCCCATGCACTTGGAGG - Intronic
1012427944 6:99134762-99134784 CAAATGCTCCATGCCCTTGGTGG + Intergenic
1012611695 6:101227164-101227186 ATAACACCCCATGCACTTGGAGG + Intergenic
1012748898 6:103132231-103132253 AGAATGCTGAATGTACTTGGAGG - Intergenic
1013735025 6:113215783-113215805 ATTTTGCACCAGGCACTTGGGGG - Intergenic
1014421957 6:121257292-121257314 ATAGTGCTTCATGCAGTAGGAGG - Intronic
1017941205 6:159054880-159054902 GTAAAGCTCCATGCACCTTGTGG - Intergenic
1020307027 7:6843253-6843275 AGCATGCTCCATGCACTTAAAGG + Intergenic
1020311503 7:6872097-6872119 ATCACGCTCCATGCACTTGAAGG + Intergenic
1020323071 7:6954435-6954457 ATAATGCTCCATGCACTAGAAGG + Intergenic
1021125776 7:16850285-16850307 ATAATTCTCAATGTCCTTGGTGG + Intergenic
1023106402 7:36767162-36767184 CTGATGCTTCATGCACTTGTGGG + Intergenic
1026553019 7:71383898-71383920 ATAATGCTCTATGAACATGCGGG + Intronic
1029078181 7:97952197-97952219 AGCATGCTCCATGCACTTGAAGG + Intergenic
1031725921 7:125238501-125238523 ATTATGCTACATGCACGTTGAGG + Intergenic
1032170770 7:129582812-129582834 ATAATGCACCATGTACTTAGAGG - Intergenic
1033621829 7:143068899-143068921 ATAATCCTCCAGAGACTTGGAGG + Intergenic
1034891123 7:154840139-154840161 ATAAAGCTTCAGACACTTGGTGG - Intronic
1036262050 8:7248848-7248870 ATCACACTCCATGCACTTGAAGG + Intergenic
1036304541 8:7590710-7590732 ATCACACTCCATGCACTTGAAGG - Intergenic
1036314089 8:7707387-7707409 ATCACACTCCATGCACTTGAAGG + Intergenic
1036355394 8:8038702-8038724 ATCACACTCCATGCACTTGAAGG - Intergenic
1036372993 8:8176547-8176569 ATAATGTTCCATGCATTTGAAGG - Intergenic
1036785380 8:11682137-11682159 ATAATTTTCCAAGCACTAGGTGG + Intronic
1036816612 8:11907312-11907334 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036833341 8:12038840-12038862 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036855187 8:12285405-12285427 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036877912 8:12489094-12489116 ATAATGTTCCATGCATTTGAAGG + Intergenic
1036903506 8:12689259-12689281 ATCACGCTCCATGCACTTGAAGG + Intergenic
1036906005 8:12708938-12708960 ATCATGCTCCATGCACTTGAAGG + Intergenic
1038799122 8:30733355-30733377 ATAATGCTCCATGCACTTGAAGG - Intronic
1040061221 8:43104492-43104514 ATGATGGTCCATCCACTTGACGG + Intronic
1040812403 8:51469740-51469762 TTTATGCTCCATGCACTTTCAGG + Intronic
1041008995 8:53523260-53523282 ATAATGCTCCATGCACTTGGAGG + Intergenic
1041030930 8:53734550-53734572 ATAATGCCCCATGTACTTGGAGG - Intronic
1041319392 8:56597821-56597843 GTGATGCTCCATGCTTTTGGTGG + Intergenic
1043376417 8:79654786-79654808 AGAATGCTCCCTCCAATTGGTGG + Intronic
1048957379 8:139548163-139548185 ATAATGCTCCATGCACTTGAAGG + Intergenic
1050653557 9:7799481-7799503 GTAATGGTCCATGGACTCGGGGG + Exonic
1056865843 9:90226810-90226832 ATCACGCTCCATGCACTTGAAGG - Intergenic
1056917175 9:90756093-90756115 ATCATGCTCCATGCACTTGAAGG + Intergenic
1056939658 9:90944465-90944487 ACACTGCTCCATGCACCTGGAGG - Intergenic
1057167207 9:92938403-92938425 ATAATGTTCCTCCCACTTGGTGG + Intergenic
1057941841 9:99291950-99291972 ATGAAGCTCTATGCAATTGGGGG - Intergenic
1062224088 9:135439245-135439267 ATAATGCACCATGCACTTGAAGG + Intergenic
1062355072 9:136158079-136158101 AGAAAGCTCCAGGCACTGGGAGG - Intergenic
1185909960 X:3972165-3972187 ATAATGCTCCATGCACTTGGAGG - Intergenic
1187252620 X:17612512-17612534 AAAATGCTCAATAAACTTGGGGG - Intronic
1190148365 X:47919517-47919539 ATAAAGCACCATAGACTTGGTGG + Exonic
1190425847 X:50333968-50333990 ATAATGTTCCATGCACTTGGAGG + Intronic
1191036037 X:56027460-56027482 ATAATGCCCCATGTACTTGAAGG + Intergenic
1193070212 X:77298574-77298596 AGAGTGCTCCATGCACTTGGAGG - Intergenic
1194400549 X:93434438-93434460 ATAATGCTCCATGCACTTGAAGG - Intergenic
1195377953 X:104245718-104245740 AGAATGCTGCATGAAATTGGGGG - Intergenic
1195859668 X:109369717-109369739 GTAATACTTCATGCACTGGGTGG - Intergenic
1198469643 X:136934403-136934425 TTAATTATCCATGCACTTGGAGG + Intergenic
1198970068 X:142269920-142269942 ATAATGCTCCGTGTACTTGAAGG - Intergenic
1200394080 X:155972936-155972958 ATAATGCTCCATGCACTTGAAGG + Intergenic
1200925301 Y:8648955-8648977 ATAATGCTCCATGCGCTTGGAGG - Intergenic
1200943379 Y:8807713-8807735 ATAATGCTCTATGCACATGGAGG - Intergenic
1200983609 Y:9284476-9284498 ATAATGCTCCATGTACTTGGAGG + Intergenic
1201555100 Y:15259012-15259034 ATAATGCTTCATGCACTTGAAGG - Intergenic
1201680514 Y:16640087-16640109 ATAATGCTCCATGTACTTGAAGG + Intergenic
1201696927 Y:16836231-16836253 ACAATGCTCCACGTACTTGAAGG - Intergenic
1202126759 Y:21575212-21575234 ATAATGCTCCATGTACTTGGAGG - Intergenic