ID: 1098748636

View in Genome Browser
Species Human (GRCh38)
Location 12:74269037-74269059
Sequence TATATAATGCTCCATGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 11, 1: 8, 2: 11, 3: 17, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748636_1098748645 10 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748645 12:74269070-74269092 CCTGTTAAACTCTGGGGGAAAGG No data
1098748636_1098748640 2 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748636_1098748642 4 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748642 12:74269064-74269086 AAAGGGCCTGTTAAACTCTGGGG No data
1098748636_1098748641 3 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748636_1098748643 5 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748636 Original CRISPR TATATAATGCTCCATGCACT TGG (reversed) Intergenic
901852793 1:12026663-12026685 TATCTCATGCTCCCTGCACCAGG + Intronic
902986623 1:20158426-20158448 TATATAATGCCCCATGCACTTGG - Intergenic
906693450 1:47808581-47808603 TTTACAATGCTCCATGTAATTGG - Intronic
907119607 1:51996754-51996776 AATAGATTGCTCCATGCAATAGG + Intergenic
909841266 1:80327707-80327729 TAGACAATGCTCTATGAACTTGG - Intergenic
910645200 1:89506929-89506951 TATAAAATGGTGCATCCACTTGG - Intergenic
911048957 1:93653557-93653579 TCTATAATATGCCATGCACTAGG + Intronic
911973362 1:104463754-104463776 TGTATAATGCCCCATGCACTTGG + Intergenic
914348241 1:146817972-146817994 AATAGAAGGCTCCAGGCACTTGG + Intergenic
915857626 1:159406478-159406500 TAGATAATGTTCCAGGCACAGGG + Intergenic
916102976 1:161408711-161408733 TATATAATTTTTCATGCACTTGG + Intergenic
917186669 1:172364159-172364181 TATATGATGAGACATGCACTAGG - Intronic
917775555 1:178330696-178330718 TATACACTGCTCCACTCACTAGG - Intronic
918387699 1:184026984-184027006 TGTATGAAGCTCCTTGCACTGGG - Intronic
918647196 1:186918374-186918396 TATATAATGCTCCATGCACTTGG + Intronic
919304089 1:195807870-195807892 TAGATATTGTTCTATGCACTGGG - Intergenic
920262386 1:204698089-204698111 TATATAATCCTCCCTGCCCTAGG + Intergenic
923646656 1:235828557-235828579 TATATAATGCTCCAATTATTTGG + Intronic
1065024069 10:21525401-21525423 TATATAATGCCGAAGGCACTTGG - Intronic
1065665499 10:28055993-28056015 TATATACAGCTGCATGTACTTGG - Intronic
1065972157 10:30814110-30814132 AATATAATACCCCATGCACTTGG + Intergenic
1066241456 10:33540023-33540045 TATATACTGATCCATGAAATAGG + Intergenic
1067143234 10:43673653-43673675 CAGATACTGCTCCAAGCACTTGG - Intergenic
1071282217 10:84113178-84113200 TATATAATGCTGCATGCACTTGG - Intergenic
1073357812 10:102870821-102870843 TAGAGAAGGCTCCATGCAGTAGG - Intronic
1079725174 11:23871567-23871589 TATATAGTGCTTCATGGAGTTGG - Intergenic
1080374128 11:31687419-31687441 TATTTATTGCTCAATGCATTTGG - Intronic
1083650377 11:64200178-64200200 TGTATAATGCTTCATGGCCTGGG - Exonic
1084134760 11:67169252-67169274 TATATAAAGCTACATGGATTAGG - Intronic
1085986733 11:81796632-81796654 TAGCTAATATTCCATGCACTAGG - Intergenic
1087062887 11:93999271-93999293 TTTATAATGCTTCATGTAATAGG + Intergenic
1087318648 11:96634081-96634103 TATATAATACTCTAGGCACCAGG - Intergenic
1087365385 11:97212171-97212193 TAAATAATGCTTTCTGCACTTGG - Intergenic
1090671099 11:128945927-128945949 CATATAAGCCCCCATGCACTGGG - Intergenic
1090692400 11:129197693-129197715 TATATTGTGCTCCATACATTTGG - Intronic
1091146644 11:133285937-133285959 TTTGAACTGCTCCATGCACTTGG - Intronic
1093289292 12:17301588-17301610 TGTATAATGCCCCATGCACTTGG - Intergenic
1093377155 12:18443935-18443957 TATATAATGCTTTATGAATTGGG - Intronic
1094699161 12:32851789-32851811 TTTAAAATACTCCATGCAATTGG - Intronic
1095278141 12:40315360-40315382 TCTAAAATGCTCAATGCTCTGGG - Intronic
1096361396 12:50990845-50990867 CATATAATGCCACATGCCCTAGG + Exonic
1097069495 12:56344560-56344582 TTTATTATGCGCCAGGCACTAGG - Intronic
1098748636 12:74269037-74269059 TATATAATGCTCCATGCACTTGG - Intergenic
1099644990 12:85341618-85341640 TATATAAGGTTCCAAGGACTAGG + Intergenic
1099800086 12:87445947-87445969 TATATAAAACTCCATGCTCCAGG + Intergenic
1100860180 12:98796951-98796973 TAAATGATGCTGCATGCACTAGG + Intronic
1101029255 12:100643896-100643918 TATATAATGCTCCACGAACTTGG + Intergenic
1102618884 12:114177827-114177849 TTTATAATCCTCCATTCATTGGG - Intergenic
1103179910 12:118901620-118901642 TCTATTATCCTCAATGCACTGGG + Intergenic
1104292905 12:127485556-127485578 TGTATAATGCCCCATGCATTTGG - Intergenic
1106828540 13:33552129-33552151 GATTTATTGCTCCATGTACTTGG - Intergenic
1107490508 13:40876652-40876674 TATATAATGCTCCATGCACTTGG + Intergenic
1108949172 13:56066298-56066320 TCTATAATGCTGCATGAACCAGG + Intergenic
1109294648 13:60514603-60514625 TACATAGTGCTCCCTCCACTTGG - Intronic
1109802996 13:67401901-67401923 TATATAATGCTCCATGCACTTGG - Intergenic
1110082453 13:71332795-71332817 TATATCATCCTACATGGACTTGG + Intergenic
1110147082 13:72204871-72204893 TATCTAAAGCTCTATGAACTAGG - Intergenic
1110370893 13:74738709-74738731 TATATAATTCTCTATGCAGAAGG - Intergenic
1112166600 13:96926758-96926780 ATAATAATGCTCCAGGCACTAGG + Intergenic
1113198584 13:107838444-107838466 TATATAAAGCACCATGCATTTGG + Intronic
1115061564 14:29197353-29197375 TTTATTATTATCCATGCACTGGG - Intergenic
1118784204 14:69032441-69032463 TTTATAATACTCAATGCATTTGG - Intergenic
1118963729 14:70560329-70560351 TTTATAATGGTCCAGGCACATGG + Intergenic
1119569499 14:75657880-75657902 TTTATAAAGTTCCATACACTTGG - Intronic
1120353719 14:83400512-83400534 CAAATCATGCTCAATGCACTAGG + Intergenic
1123626623 15:22231331-22231353 TTTAAAAGGCACCATGCACTTGG - Intergenic
1125536802 15:40445637-40445659 CGTATAATGCTCCATAAACTCGG - Intronic
1127096311 15:55515117-55515139 TATATAATGCTCCACGCACTTGG + Intergenic
1130547197 15:84865440-84865462 TATATATAGCTCCATATACTGGG + Intronic
1134821689 16:17252182-17252204 TATAAAATGCTGAGTGCACTGGG - Intronic
1135756450 16:25102628-25102650 TATATAATGCTCTGGGCTCTGGG - Intergenic
1139985797 16:70897573-70897595 AATAGAAGGCTCCAGGCACTTGG - Intronic
1141843806 16:86593374-86593396 TCTATTATGCTCCAAGCACTTGG - Intergenic
1144141465 17:12352701-12352723 TAAAGAATGCTCAATGAACTGGG + Intergenic
1149076121 17:52597490-52597512 TGTATAATGCCCCATGCACTTGG - Intergenic
1157885955 18:51366741-51366763 TACATTATGCTCCATGCACTCGG - Intergenic
1158915584 18:62124000-62124022 TATATGATGCTTCATGCATTAGG - Intronic
1159259061 18:65988006-65988028 TTTATAATACTGAATGCACTGGG + Intergenic
1159361536 18:67410934-67410956 TATTTAATGATACATGTACTTGG + Intergenic
1161749126 19:6081432-6081454 TATTTAATCCTTCATGCAATGGG - Intronic
1163916785 19:20247071-20247093 TATATAATGCTTTATGCACTTGG - Intergenic
1163943215 19:20513852-20513874 TATATAATGCTCCATGCACTTGG + Intergenic
1164481048 19:28611240-28611262 TGTATAATGCCCCATGCACTTGG - Intergenic
1165138927 19:33687777-33687799 TCTCTCATGCTCCATGGACTGGG + Intronic
1165381693 19:35486112-35486134 TATATAAAGCCCCTTGCACACGG - Intergenic
925978422 2:9156995-9157017 TATATAAAGCTCCTTCCACTTGG + Intergenic
926514300 2:13822082-13822104 TATAAAATGCTGCCTGCACCAGG + Intergenic
926771920 2:16385813-16385835 CCTATTATGCTCCAGGCACTCGG + Intergenic
930404615 2:50939904-50939926 TATATAATTCTAAATGCAGTGGG - Intronic
931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG + Intergenic
933671927 2:85016549-85016571 TTTATAATGCTTCATAAACTGGG - Intronic
941972784 2:171370180-171370202 TATACAATGCTACCTGGACTAGG + Intronic
942847188 2:180441150-180441172 TAAATAATTCTCCATGCTGTAGG - Intergenic
947061425 2:226170905-226170927 TTCATAATGCACCAAGCACTGGG + Intergenic
1170870623 20:20202776-20202798 CATATAAAGCTTGATGCACTGGG - Intronic
1174376952 20:50132603-50132625 TATATTGTTCTCCAAGCACTCGG + Intronic
1178286034 21:31326211-31326233 TATAGAATGCCCCATTCTCTAGG + Intronic
1178447710 21:32660765-32660787 TATATAATGCTCCATGCACTTGG - Intronic
1183806569 22:40216428-40216450 TATATAATGTGCCAAGCTCTGGG - Intronic
949836518 3:8275768-8275790 TATATAATTCTCAGTGTACTTGG - Intergenic
950866499 3:16193902-16193924 TATATACTGCTCCATGTATCAGG + Intronic
951085508 3:18508367-18508389 ACTATAATGCTTCAGGCACTAGG + Intergenic
955321203 3:57975664-57975686 TATAGAATGTTCCCTACACTGGG - Intergenic
956058312 3:65324002-65324024 TTTACAATGATCCAAGCACTGGG + Intergenic
957686823 3:83513379-83513401 TATATAAAGCTGAATGCTCTTGG - Intergenic
964522402 3:157583219-157583241 TATATAATGCTCCATGCACTTGG + Intronic
965453636 3:168870014-168870036 TATATAATGCTCAAGGCTGTAGG - Intergenic
966486173 3:180473003-180473025 TAAATAATGCTGCATGAACATGG - Intergenic
969646976 4:8436447-8436469 AATATAATTCTCCATGCAGTTGG - Intronic
971129449 4:23790085-23790107 TTTAACATTCTCCATGCACTAGG + Intronic
972263787 4:37439335-37439357 TATATGGTGGGCCATGCACTGGG + Exonic
972849646 4:43033245-43033267 TATATATTTCTCCATGTATTAGG - Intergenic
973829282 4:54742321-54742343 CATGTACTGCTCCATGAACTTGG - Intergenic
974124167 4:57675452-57675474 TATCCAATGCTACATGCTCTTGG - Intergenic
974137777 4:57840468-57840490 TATATAATGCTTCATTTAATAGG + Intergenic
974231633 4:59123082-59123104 TGGATACTGCTCCAGGCACTTGG - Intergenic
976328911 4:83805208-83805230 TGGATAATGCTGCATGAACTTGG - Intergenic
980484326 4:133435437-133435459 TGTATAATTCTTCATTCACTTGG + Intergenic
980780144 4:137483035-137483057 TATATAATGCTCCATGCACTTGG - Intergenic
983197630 4:164825121-164825143 TTTAAAATGCTCCATACACATGG - Intergenic
986556642 5:9016566-9016588 TTTGTACTGCTCCAGGCACTTGG + Intergenic
987328718 5:16835871-16835893 TTTATTATGATCCATGTACTGGG - Intronic
988813717 5:34810579-34810601 TATATAATGATTAGTGCACTGGG + Intronic
994364153 5:98891998-98892020 AATATATTGCTACATGCATTTGG - Intronic
994798644 5:104340489-104340511 AATAAAATGTTCCAGGCACTAGG - Intergenic
995473827 5:112528631-112528653 TATATAATGCTCCATGCACTTGG - Intergenic
995962695 5:117862349-117862371 TATTTATTGCTCCATACATTAGG + Intergenic
997310985 5:132882482-132882504 TTTATAATTCTCCATGTCCTTGG + Intronic
1002408136 5:179052448-179052470 TATATAATGCTCCGTGCACTTGG + Intergenic
1004526354 6:16412022-16412044 TATACAGTACTTCATGCACTTGG - Intronic
1008583083 6:52923726-52923748 TATATAATTCTCCATGCACTTGG - Intergenic
1010007758 6:71014061-71014083 TATAAAGTGCTTCAGGCACTTGG + Intergenic
1011119048 6:83929997-83930019 AATATAATTTTACATGCACTGGG - Intronic
1011257650 6:85439685-85439707 TATTTAATGCTTCATGCCTTTGG + Intergenic
1011565346 6:88666916-88666938 TGTATAATGCCCCATGCACTTGG - Intronic
1012611694 6:101227161-101227183 TATATAACACCCCATGCACTTGG + Intergenic
1015742232 6:136469111-136469133 TACCCACTGCTCCATGCACTGGG - Intronic
1015905346 6:138110835-138110857 TTTATCATGTTCCAGGCACTGGG - Intergenic
1021490566 7:21215825-21215847 TATAAAATACTCCATTTACTGGG - Intergenic
1021684014 7:23164024-23164046 TATTTATTGCTCCCTGCAATAGG - Intronic
1022092524 7:27117036-27117058 TCTATTATGCTCCTTGCAGTAGG - Intronic
1025140948 7:56463769-56463791 TATAAAATGGTTCATTCACTGGG - Intergenic
1025164979 7:56704467-56704489 CATATAATGCACTATTCACTGGG - Intergenic
1025872001 7:65443505-65443527 TGTATAATGCTGCATGAACATGG + Intergenic
1027611966 7:80372822-80372844 TTTATAATCTTTCATGCACTGGG - Intronic
1029020460 7:97359582-97359604 GATAGAATGCTCCATCCACGGGG - Intergenic
1036735916 8:11316556-11316578 TATATGATGTTCCAGGTACTAGG + Intronic
1036785379 8:11682134-11682156 TAAATAATTTTCCAAGCACTAGG + Intronic
1039278382 8:35956258-35956280 TGTATAATGCCCCATACACTTGG - Intergenic
1041008994 8:53523257-53523279 TATATAATGCTCCATGCACTTGG + Intergenic
1041030931 8:53734553-53734575 TGTATAATGCCCCATGTACTTGG - Intronic
1041319391 8:56597818-56597840 TATGTGATGCTCCATGCTTTTGG + Intergenic
1041647845 8:60271964-60271986 AATAAAATTCTCCATGCTCTAGG + Intronic
1043779253 8:84311546-84311568 TATATAAAGCTCTATGGACATGG + Intronic
1050696246 9:8282469-8282491 TATATAATGCTGCAGCCATTGGG - Intergenic
1051171152 9:14318670-14318692 TATCTACTGCACCATGCCCTGGG + Intronic
1057451248 9:95162396-95162418 TAAATAATGCTCAATGAACATGG + Intronic
1058837530 9:108871926-108871948 TTTATAATAGTCCTTGCACTGGG + Intronic
1185909961 X:3972168-3972190 TATATAATGCTCCATGCACTTGG - Intergenic
1187060311 X:15780566-15780588 TATAAAATGTTCCATGCAGCTGG - Intronic
1187598771 X:20803467-20803489 TATATGCTGCTTCATGCAATAGG - Intergenic
1188694628 X:33175416-33175438 TATATTATGCCCAAGGCACTTGG + Intronic
1189953914 X:46259285-46259307 TCTATAAAACCCCATGCACTTGG + Intergenic
1190425846 X:50333965-50333987 TATATAATGTTCCATGCACTTGG + Intronic
1193070213 X:77298577-77298599 TGTAGAGTGCTCCATGCACTTGG - Intergenic
1198161024 X:134008461-134008483 TGTATAATGCTGCATGAACATGG - Intergenic
1198469642 X:136934400-136934422 TATTTAATTATCCATGCACTTGG + Intergenic
1198666384 X:139028233-139028255 TATATAAAACTCCATCCACATGG + Intronic
1199548520 X:149032960-149032982 TATTTAATGCTACATTCAGTTGG - Intergenic
1200912154 Y:8540182-8540204 TGTATAATGTTCCATGCACTTGG - Intergenic
1200925302 Y:8648958-8648980 TTTATAATGCTCCATGCGCTTGG - Intergenic
1200943380 Y:8807716-8807738 TACATAATGCTCTATGCACATGG - Intergenic
1200983608 Y:9284473-9284495 TATATAATGCTCCATGTACTTGG + Intergenic
1202037299 Y:20647962-20647984 TGTATAATGCCCCATGTACTTGG - Intergenic
1202126760 Y:21575215-21575237 TATATAATGCTCCATGTACTTGG - Intergenic