ID: 1098748638

View in Genome Browser
Species Human (GRCh38)
Location 12:74269046-74269068
Sequence TGGAGCATTATATAAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 10, 1: 14, 2: 10, 3: 35, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748633_1098748638 -6 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748638 12:74269046-74269068 TGGAGCATTATATAAGGAAAAGG 0: 10
1: 14
2: 10
3: 35
4: 253
1098748634_1098748638 -10 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748638 12:74269046-74269068 TGGAGCATTATATAAGGAAAAGG 0: 10
1: 14
2: 10
3: 35
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748638 Original CRISPR TGGAGCATTATATAAGGAAA AGG Intergenic
906006029 1:42471257-42471279 TGGAGGATGTTAAAAGGAAAAGG - Intronic
907150563 1:52282997-52283019 TGTAGCATTACATAAGGGCAAGG + Intronic
907754219 1:57294563-57294585 TGTAGGATTATATGAGAAAAGGG - Intronic
908286740 1:62612621-62612643 TGGAAAATTATAAAAGTAAAGGG - Intronic
908584984 1:65557941-65557963 TGGAACATTAAATAAAGAAGTGG + Intronic
911251816 1:95585112-95585134 TGGATCAGTATATGTGGAAAGGG + Intergenic
912014313 1:105013624-105013646 TGGAGCAAAACAAAAGGAAACGG + Intergenic
912874226 1:113340885-113340907 AGGAGTATTTTTTAAGGAAAAGG - Intergenic
913219150 1:116645544-116645566 TTGAGCTCTAGATAAGGAAAAGG - Intronic
915022402 1:152793435-152793457 TGGATGATTATAGAAGCAAAAGG + Intronic
915995614 1:160559477-160559499 GGAAGCACTAAATAAGGAAAGGG + Intronic
916102975 1:161408702-161408724 TGAAAAATTATATAAAGAAAAGG - Intergenic
918647194 1:186918365-186918387 TGGAGCATTATATAAGGAAAAGG - Intronic
919238676 1:194881564-194881586 TGTATCAATAAATAAGGAAAAGG + Intergenic
920787350 1:209054058-209054080 AAGAGCATTACATAAGGGAAAGG + Intergenic
921661343 1:217806475-217806497 TGGACCACTATTCAAGGAAAGGG - Intronic
923908820 1:238416390-238416412 TGGAGAAATATATGAAGAAAAGG - Intergenic
923927907 1:238657018-238657040 TGGAGCTTTTTATGAGGAAATGG + Intergenic
923933682 1:238734649-238734671 TAGAGGATTTTATAAGGAATAGG - Intergenic
924227848 1:241936751-241936773 AAGAGCATTATAAAAGGTAAAGG - Intergenic
924498576 1:244614124-244614146 TGGAGTAATTTATAAGGAAAAGG - Intronic
924504140 1:244665207-244665229 GGGATAATAATATAAGGAAATGG - Intronic
1063857739 10:10273519-10273541 AGGAGCATTCTATATGGTAACGG + Intergenic
1063858274 10:10279564-10279586 TTCAGCATTATCTAAGTAAAAGG - Intergenic
1064400124 10:15014157-15014179 TGGAGCGTGATAGAAGGAAAAGG - Intergenic
1064591450 10:16896264-16896286 TGGAGCATGAGAAAAGAAAAAGG - Intronic
1066390397 10:34973472-34973494 TGGAACATGATATAAAGAAAAGG + Intergenic
1067492190 10:46720222-46720244 TGGTGCAGTATAAAAGGCAAGGG - Intergenic
1071260823 10:83917493-83917515 TGGAGCAAAATCTAAGGCAAAGG + Intergenic
1071730168 10:88240051-88240073 TAGAGCAAGATGTAAGGAAATGG + Intergenic
1072824570 10:98593413-98593435 TGGGGCATTATGTAGGCAAAGGG + Intronic
1074625556 10:115180385-115180407 TGCAGCAATATATAATGACATGG - Intronic
1076076863 10:127540258-127540280 TAGTGCATAAAATAAGGAAAGGG - Intergenic
1077345577 11:2049275-2049297 TGGAGAATGATGTATGGAAATGG - Intergenic
1077589039 11:3477540-3477562 TGGAGCATTATATAAAGAAAAGG - Intergenic
1078343087 11:10515247-10515269 TGGAGGAATATATAAGAAACTGG - Intronic
1079333253 11:19550571-19550593 AGCAGCATTGTACAAGGAAAGGG + Intronic
1080003892 11:27383807-27383829 TGCACCACTATATAAGTAAAAGG - Intronic
1082213166 11:49531369-49531391 TGGTACGTTATATAAGGTAAGGG + Intergenic
1084227716 11:67727666-67727688 TGGACCATGATAGAAAGAAAAGG - Intergenic
1084244734 11:67849163-67849185 TGGAGCATTATATAAAGAAAAGG - Intergenic
1084261122 11:67979353-67979375 TGGAGCGTGATAGAAAGAAAAGG - Intergenic
1084681717 11:70670261-70670283 TGGAGCACTATATTAGAAAGAGG + Intronic
1084811526 11:71614742-71614764 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
1084844608 11:71889206-71889228 TGGAGCGTGATAGAAAGAAAAGG + Intronic
1084847459 11:71911664-71911686 TGGAGCGTGATAGAAAGAAAAGG + Intronic
1086119159 11:83287414-83287436 AGGATCATTAGATGAGGAAAGGG - Intergenic
1086636433 11:89093150-89093172 TGGTACATTATATAAGGTAAGGG - Intergenic
1087913314 11:103778539-103778561 TGCAACATTATATAAGTCAAAGG + Intergenic
1087930443 11:103971926-103971948 GGGAGGATTATAGAAGAAAATGG + Intronic
1090530252 11:127583457-127583479 TGGAGCAGTAACTGAGGAAAAGG - Intergenic
1091044995 11:132317519-132317541 TGGGGGATTATATAAAAAAAAGG - Intronic
1091676051 12:2490811-2490833 TGGACCCTGAAATAAGGAAATGG + Intronic
1091831464 12:3553641-3553663 TGGAGCATTCGATCTGGAAAGGG - Exonic
1092363530 12:7858158-7858180 TAGGGAATTATTTAAGGAAATGG - Intronic
1092415298 12:8286308-8286330 TGGAGCATTATATAAAGAAAAGG - Intergenic
1092778163 12:11962020-11962042 TGGAGCATGATGTAAAGACAGGG - Intergenic
1092891512 12:12973542-12973564 TGGTGAATGAGATAAGGAAAAGG - Intergenic
1093273813 12:17099020-17099042 TGGAGCATTTTCTTTGGAAAAGG - Intergenic
1093885252 12:24452084-24452106 TTGAGCCTTATATAAGCAATTGG - Intergenic
1094317977 12:29152987-29153009 TGAAGTTTTATGTAAGGAAAAGG + Intronic
1095988864 12:48019873-48019895 TGCAGCATTATCTCAGCAAAAGG - Exonic
1097502353 12:60420245-60420267 TGGATCATCAGATAGGGAAAAGG + Intergenic
1098195718 12:67999752-67999774 TGGGGCAATATATAAGAAACAGG + Intergenic
1098748638 12:74269046-74269068 TGGAGCATTATATAAGGAAAAGG + Intergenic
1099624744 12:85056578-85056600 TGGATTATTATATAAAGATAAGG + Exonic
1099939189 12:89164689-89164711 AGGAGGATTATATAAAGGAATGG - Intergenic
1100074261 12:90759616-90759638 TGGACCAGTATATAGGAAAATGG + Intergenic
1100878012 12:98983492-98983514 TGGTGCATTATATGACAAAAGGG - Intronic
1101598092 12:106185009-106185031 TGGATCATTTTATAATAAAAAGG + Intergenic
1106822076 13:33476479-33476501 TGGTACATTATTTAAGTAAAAGG + Intergenic
1107490507 13:40876643-40876665 TGGAGCATTATATAAAGAAAAGG - Intergenic
1107544162 13:41421475-41421497 TGGAGCGTGATAGAAAGAAAAGG - Intergenic
1107843393 13:44483902-44483924 TGGACCATTTTTTAATGAAAAGG - Intronic
1108849871 13:54715229-54715251 TTGTGTAATATATAAGGAAAAGG + Intergenic
1108946375 13:56030409-56030431 TTGCACATTATATAAGCAAATGG + Intergenic
1109391355 13:61697769-61697791 TTGAGCATTATATAGGAAAATGG + Intergenic
1109584101 13:64375252-64375274 TGGAGAATTACATTAGGAATAGG + Intergenic
1109613992 13:64807419-64807441 TGCAGCATTATAGATGGAACTGG - Intergenic
1109802998 13:67401910-67401932 TGGAGCATTATATAAGGAAAAGG + Intergenic
1111224348 13:85249993-85250015 TGTATCATTATATAAAGTAATGG + Intergenic
1111592445 13:90367681-90367703 TGGAACAATATATAAGAAAATGG - Intergenic
1112798994 13:103089669-103089691 TGGACCATGATATGAGGAGAGGG + Intergenic
1113752060 13:112783411-112783433 TGGAGCATGAAATGAGGCAACGG - Intronic
1115028001 14:28765780-28765802 TGGAGCAGGAGAGAAGGAAAAGG + Intergenic
1116039380 14:39667086-39667108 TGGAGCATGCTCTAAGGAAATGG + Intergenic
1116753924 14:48922044-48922066 TGGAGCATAATAGAAGTAGAAGG - Intergenic
1117036098 14:51731365-51731387 TGGAGAATTAGATAAGGTAATGG + Intergenic
1117502152 14:56363729-56363751 TGAAGCACTAAATATGGAAAGGG - Intergenic
1118466794 14:66038501-66038523 TTGAACATTATATTAGGTAATGG - Intergenic
1118475314 14:66110698-66110720 TGAATCTTTATATTAGGAAAAGG - Intergenic
1119084909 14:71730784-71730806 GCAAGCATTATGTAAGGAAAAGG + Intronic
1119946558 14:78701200-78701222 TGGAGCATTCAATAAGGCAAAGG + Intronic
1120779952 14:88478454-88478476 TGGAGAATTATATTAGGATTGGG + Intronic
1124795041 15:32770080-32770102 TGGAGCTTTATATGACAAAAAGG - Exonic
1125199363 15:37087346-37087368 TGGAGCACAATAGAAGGAGATGG + Intronic
1127096309 15:55515108-55515130 TGGAGCATTATATAAGGAAAAGG - Intergenic
1127557174 15:60099149-60099171 GTGAGCATTAAATAAGTAAATGG - Intergenic
1127681077 15:61299030-61299052 TGGATCATCGTATAAAGAAAAGG - Intergenic
1129263721 15:74383000-74383022 TAGAGCATTATTTTGGGAAAGGG - Intergenic
1130419522 15:83730241-83730263 TGGAACATTATAGAAGGCACTGG + Intronic
1131447101 15:92509247-92509269 TTCTGCATTATATAAGGTAAGGG - Intergenic
1135666661 16:24341349-24341371 AGAAGCAATATAGAAGGAAAAGG - Intronic
1137769833 16:51007207-51007229 TGGAACATTACATCAGGAAGTGG + Intergenic
1138445904 16:57063414-57063436 TGCAGCCTTAAAAAAGGAAAGGG - Intronic
1138773609 16:59694068-59694090 AGGAAAACTATATAAGGAAAAGG + Intergenic
1140909490 16:79438472-79438494 CGGAGAATTATGTAAGGAACGGG + Intergenic
1151368652 17:73633312-73633334 TTTAGAAATATATAAGGAAAAGG + Intronic
1153688811 18:7570557-7570579 TGGACCAATATATAATAAAATGG + Intronic
1155324296 18:24650501-24650523 TGGACAGTTATCTAAGGAAATGG + Intergenic
1156654466 18:39268433-39268455 TGAAGCACTTTTTAAGGAAATGG - Intergenic
1156939365 18:42746491-42746513 TAGAGCATTATTTGAGTAAAAGG + Intronic
1158129918 18:54140998-54141020 TGAAGCAATTTATAAAGAAAGGG + Intergenic
1159083856 18:63765274-63765296 TGACGGATTTTATAAGGAAAGGG - Intronic
1160488332 18:79314092-79314114 TGGAGCTTTATTTAGGGAAATGG + Intronic
1162284209 19:9726129-9726151 TGGAGCATTATATAAGGAAAAGG - Intergenic
1162457357 19:10793706-10793728 TGGACCATCCTATGAGGAAAAGG - Exonic
1163285931 19:16347784-16347806 TGGAAAAATATAAAAGGAAATGG - Intergenic
1163943213 19:20513843-20513865 TGGAGCATTATATAAGGAAAAGG - Intergenic
1163966377 19:20750835-20750857 TGGAGCATTATGTAAAGAAAAGG - Intronic
1165294361 19:34914707-34914729 TTGAGCATCATTTAAGGACATGG + Intergenic
1167942600 19:52959674-52959696 TAAAGCATTATATAAAGAAAAGG + Intronic
1168673333 19:58258124-58258146 AGGAGCATGAAATGAGGAAAGGG - Intronic
926807366 2:16723338-16723360 TGGAGGATTCTATAATAAAAAGG + Intergenic
926895004 2:17677228-17677250 TCAAGCCTAATATAAGGAAAGGG - Intronic
927117967 2:19923809-19923831 TTGAGCAATTTAAAAGGAAAAGG - Intronic
927900935 2:26817768-26817790 TGGAGCATGAAATGAAGAAAAGG - Intergenic
928813985 2:35267084-35267106 AGGAGAATTATCTAAGGAAGAGG - Intergenic
929377080 2:41300190-41300212 TGCAGCTTTAGATAAGGGAAAGG + Intergenic
930200620 2:48549268-48549290 GGGAGCATCATATAAGGCAATGG - Intronic
930361569 2:50386908-50386930 TGGAGTATTGTATAAGGCATAGG - Intronic
931808549 2:65831581-65831603 TGGGGCTTTATATCAGGAATGGG + Intergenic
932349941 2:71023588-71023610 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
932353436 2:71049726-71049748 TAGAGGATTATAGAAAGAAAAGG + Intergenic
934649162 2:96079807-96079829 AGGGGCATTACATAAGAAAAAGG - Intergenic
935875509 2:107502493-107502515 GGGAGCATTTTAGAAGGAATCGG + Intergenic
935915743 2:107947576-107947598 TTAAGTATTTTATAAGGAAAAGG + Intergenic
937748811 2:125448500-125448522 TGCAGCACTATATAGGGATAAGG - Intergenic
939134344 2:138275617-138275639 TGGGGCAATATATAGGGAGAGGG - Intergenic
939751304 2:146050694-146050716 CTGAGCATTATATAAGCATAGGG - Intergenic
939774698 2:146369846-146369868 TGGAGGATTATATAAATTAAAGG - Intergenic
940092735 2:149939013-149939035 GGGATCATTCAATAAGGAAATGG - Intergenic
940869521 2:158848365-158848387 TGGAGCGTGATAGAAAGAAAAGG + Intronic
940872197 2:158869363-158869385 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
940874404 2:158885351-158885373 TGGAGCATGATAGAAAGAAAAGG + Intergenic
941562402 2:167063659-167063681 TGAAACATTATATAATGAAAAGG - Intronic
941708010 2:168680363-168680385 TGGAGAATAATGCAAGGAAAGGG + Intronic
942637926 2:178028464-178028486 TGGTGCTTTATTTAAGGAAAAGG - Intronic
942700111 2:178698004-178698026 TGGATGAATACATAAGGAAAAGG + Intronic
943358402 2:186888056-186888078 TGGAGAAGAAGATAAGGAAAAGG - Intergenic
945912665 2:215667519-215667541 TGAGGCAGTATATAAGAAAAGGG + Intergenic
946611964 2:221468313-221468335 TGGAGAACAATGTAAGGAAAAGG + Intronic
947027349 2:225751556-225751578 TGGAGCATTATAGACAGAACTGG + Intergenic
947594998 2:231405509-231405531 TGAAGCATCATATAAAGAAAAGG + Intergenic
947966679 2:234287940-234287962 TGAACCATGCTATAAGGAAAAGG - Intergenic
948621179 2:239235655-239235677 TGGAGGATTCTATGTGGAAACGG + Intronic
1171408542 20:24930227-24930249 TGGAGCGTTATATAAAGAAAAGG + Intergenic
1171932513 20:31241304-31241326 TGGAGCATAATGTAACGGAATGG + Intergenic
1171994435 20:31721301-31721323 TGAACCATTGTATAAGGTAAGGG + Intronic
1174757151 20:53170738-53170760 TAGACCTTTATATAATGAAAGGG + Intronic
1175178896 20:57130960-57130982 TGGAGCAATACTTAGGGAAAGGG + Intergenic
1178447712 21:32660774-32660796 TGGAGCATTATATAAGGAAAAGG + Intronic
1179368000 21:40776654-40776676 TGGAGCATGATTTAAGGTGAAGG + Intronic
1182794581 22:32981642-32981664 TTGAGGATTAAATAAGAAAAAGG + Intronic
949187446 3:1209869-1209891 GGGAGCATGATTAAAGGAAAAGG - Intronic
951019755 3:17769680-17769702 TGGAGCAATAAATAAGTAAATGG - Intronic
951166014 3:19485903-19485925 TGGAGCATTATACAAGAAAAAGG - Intronic
952860897 3:37811509-37811531 TGGAGCCCTAAATAAGGGAAGGG - Intronic
953581774 3:44163784-44163806 TGGAGCCTTCTCTAAGGAAATGG - Intergenic
955002548 3:54940555-54940577 TGCTGCATTATATAAAGACAAGG - Intronic
956252055 3:67244697-67244719 TTGAGCATTACCAAAGGAAAAGG + Intergenic
956541510 3:70344819-70344841 TGGAGCATCTTGTAATGAAACGG - Intergenic
957044393 3:75362731-75362753 TGGAGCATGATAGAAAGAAAAGG - Intergenic
957076189 3:75604914-75604936 TGGAGCATGATAGAAAGAAAAGG - Intergenic
957527062 3:81391284-81391306 TGGAGTATTTTATAAGGCTACGG + Intergenic
957562329 3:81838414-81838436 TGGGTCATTTTTTAAGGAAAAGG + Intergenic
957765076 3:84613789-84613811 TGGAACATTAGTTAAGGCAAAGG + Intergenic
958717978 3:97809782-97809804 CAGAGCATTATAGAAGGAAAAGG + Intergenic
959115393 3:102171641-102171663 TGGGGCATTATAAAGGGAAATGG - Intronic
960231494 3:115233068-115233090 TGGAGAGTGATAGAAGGAAAGGG + Intergenic
961275110 3:125720268-125720290 TGGAGCATGATAGAAAGAAAAGG + Intergenic
961876387 3:130026765-130026787 TGGAGCATGATAGAAAGAAAAGG - Intergenic
961892848 3:130144922-130144944 TGGAGCATTATATAAAGAAAAGG - Intergenic
964381307 3:156100874-156100896 TGGAACAATATATAAAGGAAGGG - Intronic
964522400 3:157583210-157583232 TGGAGCATTATATAAGGAAAAGG - Intronic
964834498 3:160922476-160922498 TGGAGAATTATATGAGTAATCGG - Intronic
964953762 3:162327187-162327209 TGCAGCAATATAGAAAGAAAGGG + Intergenic
965036546 3:163446504-163446526 GGGAGTATTAAATATGGAAATGG + Intergenic
965192561 3:165550080-165550102 TGAAGCATAATATAAGGAATTGG + Intergenic
965888217 3:173476082-173476104 TGGAGAATTACCTAAGGAGAAGG + Intronic
969019639 4:4131214-4131236 TGGAGCATGATAGAAAGAAAAGG - Intergenic
969734212 4:8976194-8976216 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
969749915 4:9102219-9102241 TGGAACATTATATAAAGAAAAGG + Intergenic
969785641 4:9455080-9455102 TGGAGCATGATAGAAAGAAAAGG + Intergenic
969789062 4:9479490-9479512 TGGAGCATGATAGAAAGAAAAGG + Intergenic
969793799 4:9510258-9510280 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
971202122 4:24519584-24519606 TGTAGCACTACTTAAGGAAAAGG + Intronic
971447477 4:26766311-26766333 TGGAGCACTGTATGAGGAACAGG + Intergenic
972081526 4:35157324-35157346 TTTAGCTTTATATAAGGTAAGGG - Intergenic
972210858 4:36835360-36835382 TGGAGCATTATACAAGTCTAGGG + Intergenic
973943103 4:55930390-55930412 TGGAAAATTATATCAAGAAAGGG - Intergenic
974359857 4:60863605-60863627 TGGAGTTTTATAGAAGGCAAAGG + Intergenic
974390973 4:61267625-61267647 TGAATCATGATATCAGGAAAAGG - Intronic
976106949 4:81629426-81629448 TATAGCAATATATAAGGAGAGGG - Intronic
976936047 4:90634665-90634687 TGGATAATTAGAGAAGGAAATGG + Intronic
977134071 4:93280200-93280222 TGGAGCATTATATCATAAACTGG + Intronic
978218139 4:106233130-106233152 TTGTTCATTAAATAAGGAAAAGG + Intronic
978752717 4:112270618-112270640 TGAAGCATGTTATAAGCAAAGGG + Intergenic
978862656 4:113469487-113469509 TGCAGCATGAGATAAGGAGAGGG - Intronic
979127456 4:116992762-116992784 TGCAGCATTAAATGAGGTAATGG - Intergenic
979277865 4:118833464-118833486 ATGATCATTATATAATGAAATGG - Intronic
979982722 4:127276395-127276417 TGGAGTAGTTTAAAAGGAAAAGG + Intergenic
980780146 4:137483044-137483066 TGGAGCATTATATAAGGAAAAGG + Intergenic
980816881 4:137959241-137959263 TTAAGCATTATATAATCAAAGGG + Intergenic
982508259 4:156247939-156247961 TGGAGCATTATATGGGAACAGGG + Intergenic
982639785 4:157944172-157944194 AGGAGCATGATCTGAGGAAATGG + Intergenic
982724565 4:158891880-158891902 TGGTGCAGTAAATAAGGAATGGG + Intronic
984028829 4:174577545-174577567 TGCAGTAGTATTTAAGGAAAAGG + Intergenic
984089175 4:175349104-175349126 TGGAAAATTAAAAAAGGAAATGG - Intergenic
986966326 5:13276381-13276403 TGGAGCATTAAATAACCAAAAGG + Intergenic
987327290 5:16823894-16823916 TGGAGCATAAACTATGGAAAAGG + Intronic
987569070 5:19631993-19632015 AGGAAAATTATGTAAGGAAATGG - Intronic
989859324 5:46347027-46347049 TTGAGGATTTCATAAGGAAAGGG - Intergenic
990276547 5:54203038-54203060 GGGAGCTTTATATAAGTACATGG - Intronic
990853075 5:60228990-60229012 TGCAGCAATATATAAGGTAACGG + Intronic
992377076 5:76198522-76198544 TGGGGCAGTTTATAAAGAAAAGG - Intronic
993344575 5:86766520-86766542 TGTAGTATTTTATAAGGAGAGGG + Intergenic
995473829 5:112528640-112528662 TGGAGCATTATATAAGGAAAAGG + Intergenic
998789638 5:145752182-145752204 TTGAGCCTTATTAAAGGAAAGGG - Intronic
998862306 5:146456346-146456368 TGGAGTATTATAAAATGTAATGG + Intronic
999023986 5:148204645-148204667 TGGAGAATTAAATGAGAAAAAGG + Intronic
1001590671 5:172862514-172862536 TGGAGAATTCTTCAAGGAAAAGG - Intronic
1002061628 5:176629157-176629179 CGAAGCATTACATGAGGAAATGG + Intronic
1004310230 6:14539117-14539139 CAGAGCATTACAGAAGGAAAGGG - Intergenic
1006985004 6:38170136-38170158 TGGAGCATTATGCCAGGAACAGG + Exonic
1007904703 6:45448015-45448037 TGGAGTAGTATTTAAGGAAATGG + Intronic
1008583084 6:52923735-52923757 TGGAGAATTATATAAAGAAAAGG + Intergenic
1010254592 6:73743373-73743395 TGGAGCCCTGTATAATGAAACGG + Intronic
1010463993 6:76145319-76145341 TTAAGCATTATACCAGGAAAAGG + Intergenic
1010583357 6:77627000-77627022 TGGAGCATCATAGGAGCAAAGGG - Intergenic
1011495220 6:87930716-87930738 TGCAACCATATATAAGGAAAGGG + Intergenic
1013295268 6:108753214-108753236 TGGGGCATTATTTAAGCAATGGG + Intergenic
1016327268 6:142916530-142916552 GGGAGCATTAAATAAGTGAAGGG - Intronic
1017243923 6:152201392-152201414 TAGACCATTATGCAAGGAAAGGG - Intronic
1017258366 6:152360066-152360088 TGGAGCATGAAATAAGGGACAGG - Intronic
1020307026 7:6843241-6843263 TGGAGCATGCTAGAAAGAAAAGG - Intergenic
1020311502 7:6872085-6872107 TGGAGCGTGATAGAAAGAAAAGG - Intergenic
1020323070 7:6954423-6954445 TGGAGCATTATATAAAGAAAAGG - Intergenic
1021195155 7:17666438-17666460 TGAAACATTAAATAAAGAAATGG - Intergenic
1021341971 7:19476096-19476118 TGGAGCTTTATATAGCAAAAGGG - Intergenic
1022412612 7:30150793-30150815 TGGAGCCATTTCTAAGGAAACGG - Intronic
1023196359 7:37643888-37643910 TGGAGCTTTATGGGAGGAAATGG + Intergenic
1026130103 7:67613153-67613175 AGGAGGATTATATCAGGAATGGG + Intergenic
1028474862 7:91242007-91242029 TGGAGCATAATATATCAAAAGGG - Intergenic
1028686596 7:93596541-93596563 TGGATAATTTTTTAAGGAAAAGG + Intronic
1029078180 7:97952185-97952207 TGGAGCATGCTAGAAAGAAAAGG - Intergenic
1029208921 7:98888975-98888997 TGAAGCATTAAACAAGAAAAAGG + Intronic
1029858137 7:103539777-103539799 TGGAGCAGTCTATAAGGATGTGG + Intronic
1030094232 7:105883728-105883750 TGGAGCATTAATTAAGGAAATGG - Intronic
1030769298 7:113454377-113454399 TGGAGCAGTAGAGAAGGACAAGG - Intergenic
1030810843 7:113970467-113970489 TGAAACATTATATAAAGAATAGG + Intronic
1031742747 7:125455246-125455268 TGGAGCATTAGATAAGGCCTGGG - Intergenic
1032837511 7:135687741-135687763 TGGTACATTATATAAAGAGATGG + Intronic
1032945423 7:136846551-136846573 AGGAGCGTTATATCAGGACAGGG + Intergenic
1033811204 7:145014101-145014123 TTGAGCATTATATAGTGAAAAGG + Intergenic
1035594113 8:841133-841155 TGGAGCAGTTCATATGGAAAAGG + Intergenic
1035901533 8:3462303-3462325 TGTAGCATCATTTAAGGCAAGGG + Intronic
1036239828 8:7072318-7072340 TGGAGCATTCTAGAAAGAGAAGG + Intergenic
1036372994 8:8176559-8176581 TGGAACATTATATAAAGAAAAGG + Intergenic
1036816611 8:11907300-11907322 TGGAGCGTGATAGAAAGAAAAGG - Intergenic
1036877911 8:12489082-12489104 TGGAACATTATATAAAGAAAAGG - Intergenic
1036903505 8:12689247-12689269 TGGAGCGTGATAGAAAGAAAAGG - Intergenic
1037791004 8:21941660-21941682 AGGCCAATTATATAAGGAAATGG + Intronic
1038799123 8:30733367-30733389 TGGAGCATTATATAAAGAAAAGG + Intronic
1039223915 8:35366533-35366555 TGGACAATTACATAAGCAAATGG - Intronic
1039273482 8:35908740-35908762 CTGTGCATTATATAAGGAAAGGG + Intergenic
1041888577 8:62842831-62842853 TGGAGCATAGTGTAAGGTAAGGG - Intronic
1042017904 8:64337606-64337628 TATAGCAATATATAAAGAAAAGG + Intergenic
1042914878 8:73865840-73865862 TGCAGCAATATTTAAAGAAAAGG + Intronic
1043260875 8:78194058-78194080 TAAAGGATTATATAGGGAAAAGG + Intergenic
1043452024 8:80377440-80377462 TGCAGAATTATCAAAGGAAAAGG - Intergenic
1043495295 8:80793559-80793581 TAAAGCATAATATAAAGAAATGG + Intronic
1043705528 8:83344217-83344239 TGTAGAATTATATAATTAAAGGG - Intergenic
1044216907 8:89623047-89623069 TGGGGCAATTTATAAGAAAAGGG + Intergenic
1044386356 8:91593491-91593513 TGGAGCATGACAAAAGTAAATGG + Intergenic
1044549897 8:93500296-93500318 AGGACCATGATATAAGAAAATGG + Intergenic
1044580930 8:93825550-93825572 TGAAGCATAATAGAAGGAACTGG + Intergenic
1046339941 8:112840605-112840627 TTGATCATTATATAAGGTATAGG + Intronic
1047549718 8:125857192-125857214 TGGAGTTATAAATAAGGAAAGGG - Intergenic
1048067714 8:130987615-130987637 AGGATCATTATCCAAGGAAAAGG + Intronic
1048376315 8:133825674-133825696 TGGTGTATTATAGAAGGAGACGG + Intergenic
1048633736 8:136273103-136273125 TACAGCATAATATAATGAAACGG - Intergenic
1048957378 8:139548151-139548173 TGGAGCATTATATAAAGAAAAGG - Intergenic
1050946015 9:11518846-11518868 AGCAGCATTATATAATGAAGTGG + Intergenic
1054704181 9:68446012-68446034 TGGAGCATCATACAAGGTAGTGG - Intronic
1056865844 9:90226822-90226844 TGGAGCGTGATAGAAAGAAAAGG + Intergenic
1056917174 9:90756081-90756103 TGGAGCATGATAGAAAGAAAAGG - Intergenic
1057549909 9:96044856-96044878 GGGAGCATTCCATAATGAAATGG + Intergenic
1057912036 9:99026687-99026709 TGGAGGATGACAAAAGGAAAAGG - Intronic
1057933171 9:99213469-99213491 TGAAGTATCATATAAAGAAATGG + Intergenic
1062224087 9:135439233-135439255 TGGTGCATTATATAAAGAAAAGG - Intergenic
1185909962 X:3972177-3972199 TGGAGCATTATATAAGTAAAAGG + Intergenic
1186442683 X:9599652-9599674 CAGAGCCTTGTATAAGGAAATGG - Intronic
1186536559 X:10355977-10355999 GGGAATATTATAGAAGGAAAGGG + Intergenic
1187267609 X:17749749-17749771 TGAAGAATTATATAATCAAAAGG + Intronic
1187550413 X:20297353-20297375 TGGAGAATTATAGAAGAAATAGG + Intergenic
1189770923 X:44426298-44426320 TGGAGCATTACAAATGGTAAAGG + Intergenic
1190425844 X:50333956-50333978 TGGAACATTATATAAGGAGAAGG - Intronic
1194185714 X:90772788-90772810 TAGTGCATTATATAAAAAAAGGG + Intergenic
1194400550 X:93434450-93434472 TGGAGCATTATATAAAGAAAAGG + Intergenic
1195747563 X:108134213-108134235 TGGAGCCACATATAAGGCAAGGG - Intronic
1195811023 X:108830034-108830056 TAGAATATTAGATAAGGAAAGGG - Intergenic
1195856322 X:109336525-109336547 GGAAGCATTAAATATGGAAAGGG - Intergenic
1198469641 X:136934391-136934413 TGGATAATTAAATAAAGAAAAGG - Intergenic
1198613076 X:138423647-138423669 TGAATCTTTTTATAAGGAAATGG - Intergenic
1198684234 X:139210744-139210766 GGGAGCATGCTATGAGGAAAAGG - Intronic
1199590601 X:149464896-149464918 TGGGCCAATATATATGGAAATGG - Intergenic
1200394079 X:155972924-155972946 TGGAGCATTATATAAGTAAAAGG - Intergenic
1200948286 Y:8867407-8867429 TGGAGCATTATATAAAGAAAAGG + Intergenic
1201455472 Y:14163480-14163502 TGCTGCAATATAGAAGGAAAGGG + Intergenic
1201555102 Y:15259024-15259046 TGAAGCATTATATAAGGAAAAGG + Intergenic
1202126761 Y:21575224-21575246 TGGAGCATTATATAAAGAAAAGG + Intergenic