ID: 1098748639

View in Genome Browser
Species Human (GRCh38)
Location 12:74269047-74269069
Sequence GGAGCATTATATAAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 9, 1: 18, 2: 24, 3: 76, 4: 613}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748633_1098748639 -5 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613
1098748635_1098748639 -10 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613
1098748634_1098748639 -9 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG 0: 9
1: 18
2: 24
3: 76
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748639 Original CRISPR GGAGCATTATATAAGGAAAA GGG Intergenic
900075609 1:814483-814505 GTAGCTTTATATCAGGAAAATGG - Intergenic
902848244 1:19129592-19129614 AGAACATTATATTAGGAAGATGG - Intronic
902986624 1:20158436-20158458 GGGGCATTATATAAAGAAAAAGG + Intergenic
903308521 1:22432700-22432722 GGAACAATATATAAGAAAAATGG - Intergenic
905963420 1:42065481-42065503 GGAGAATTATATAAAGTAATAGG + Intergenic
905987405 1:42299343-42299365 TGAGCATTATATAATGATAAAGG - Intronic
906006028 1:42471256-42471278 GGAGGATGTTAAAAGGAAAAGGG - Intronic
906592828 1:47043828-47043850 AGACCATTATATAATGAGAAAGG - Intronic
907001430 1:50862796-50862818 GGGACATTATATAATGATAAAGG + Intronic
907704127 1:56818555-56818577 GGAGAATTGGAGAAGGAAAAAGG + Intronic
908012452 1:59792956-59792978 GGGTCATTACATAAGGATAAAGG + Intergenic
908697075 1:66855620-66855642 GGGGCATTACATATGAAAAATGG + Intronic
908744705 1:67364551-67364573 GGAGCATTACTTAATGATAAAGG + Intronic
908980152 1:69946634-69946656 AGAACATTATATAATGATAAAGG - Intronic
909268664 1:73595149-73595171 AGAACAATATATAAGCAAAAAGG + Intergenic
909463514 1:75946031-75946053 GGGTCATTATATAATGATAAAGG + Intergenic
909852368 1:80484201-80484223 GGCGGATTAAATAAAGAAAATGG + Intergenic
910174298 1:84412656-84412678 GGAGCAAAAGAAAAGGAAAAAGG + Intronic
910850595 1:91646195-91646217 GGAGCTTTATGTCAGGAAACAGG + Intergenic
911020197 1:93378461-93378483 AGGTCATTATATAATGAAAAAGG + Intergenic
911083242 1:93954368-93954390 AGGTCATTATATAAGGATAAAGG - Intergenic
911973361 1:104463744-104463766 GGGGCATTATACAAAGAAAAAGG - Intergenic
913301368 1:117373355-117373377 TGAGCAATTTATAAGGGAAATGG - Intronic
913440025 1:118887301-118887323 TGAGCATTATAAAAGGGTAAAGG + Intronic
914987932 1:152475817-152475839 GGAGTATTCTAACAGGAAAAGGG + Intergenic
915073349 1:153290169-153290191 TGGGCATTCAATAAGGAAAATGG + Intergenic
915659733 1:157392739-157392761 GGGTCATTATATAATGATAAAGG - Intergenic
916102974 1:161408701-161408723 GAAAAATTATATAAAGAAAAGGG - Intergenic
917585483 1:176422915-176422937 GGGGCATTACATAATGATAAAGG - Intergenic
917694284 1:177505020-177505042 GGAGCATTCTATACTGATAAAGG + Intergenic
918126894 1:181592222-181592244 AGAACATTTAATAAGGAAAAGGG - Intronic
918493298 1:185106442-185106464 GGAACATGATATAGGGAGAAAGG + Intergenic
918600566 1:186354416-186354438 TGAGGATTATAGAAGAAAAAAGG - Intronic
918647193 1:186918364-186918386 GGAGCATTATATAAGGAAAAGGG - Intronic
918918847 1:190678388-190678410 GAAGCATTTTATAGAGAAAATGG - Intergenic
919103138 1:193118213-193118235 AGAGCATTATGTAATGATAAGGG + Intergenic
919452949 1:197791983-197792005 GGGTCATTATATAATGATAAAGG + Intergenic
919552966 1:199015216-199015238 TGAGCATCATATAAGGGAAGTGG - Intergenic
920137789 1:203784204-203784226 GGGGCATTAAATAATGACAAAGG - Intergenic
920616659 1:207499264-207499286 GGGGCATCATATAATGATAAAGG + Intronic
920787351 1:209054059-209054081 AGAGCATTACATAAGGGAAAGGG + Intergenic
922271452 1:224039357-224039379 GTAGCTTTATATCAGGAAAATGG - Intergenic
922446159 1:225699060-225699082 GCAGCTTTCTATAAAGAAAAAGG - Intergenic
922927153 1:229359148-229359170 GGGACATTATATATGGTAAAAGG - Intergenic
922995740 1:229958385-229958407 GGGACATTATATATGGTAAAAGG - Intergenic
923216138 1:231849612-231849634 GGATCATTTGATAAGCAAAATGG - Intronic
923288770 1:232523630-232523652 TGAGCATTTTATAAGAAAACTGG + Intronic
923440174 1:234010864-234010886 AGGGCATTATATAATGATAAAGG + Intronic
923908819 1:238416389-238416411 GGAGAAATATATGAAGAAAAGGG - Intergenic
923927908 1:238657019-238657041 GGAGCTTTTTATGAGGAAATGGG + Intergenic
924035954 1:239937615-239937637 GGAACATTTTATAATTAAAAAGG + Intergenic
924273186 1:242356299-242356321 AGGGCATTATATAATGATAAAGG - Intronic
924321202 1:242852882-242852904 GGGACATTATATAAGGTAAAAGG - Intergenic
1063266812 10:4460483-4460505 GCAGGATTATATAAGAAATATGG + Intergenic
1063858273 10:10279563-10279585 TCAGCATTATCTAAGTAAAAGGG - Intergenic
1064400123 10:15014156-15014178 GGAGCGTGATAGAAGGAAAAGGG - Intergenic
1066148585 10:32589785-32589807 GGAGCATTATGTAATGATAAAGG - Intronic
1066390398 10:34973473-34973495 GGAACATGATATAAAGAAAAGGG + Intergenic
1066514923 10:36147910-36147932 AGGGCATTATATAATGATAAAGG + Intergenic
1066711535 10:38240350-38240372 AGGGCATTATATAATGATAAAGG + Intergenic
1067672537 10:48336884-48336906 AGGGCATTATATAATGACAAAGG + Intronic
1067722546 10:48740093-48740115 GGAGCTTTGTTTAAGGCAAATGG - Intronic
1068034142 10:51739011-51739033 GGAGCATTAAACAAGTAACATGG - Intronic
1068048862 10:51923128-51923150 GGGGCATTACATAATGATAAAGG - Intronic
1068138429 10:52974164-52974186 GGAGCATTGTTTTGGGAAAATGG + Intergenic
1069647426 10:70012390-70012412 GGGGCATTACATAATGATAAAGG + Intergenic
1070317724 10:75331902-75331924 GTATCATTATATAAGGATAAAGG - Intergenic
1071148722 10:82607317-82607339 GGAGCATTACATAATGAAGAAGG - Intronic
1071174717 10:82912383-82912405 GGAGCATTATATAATGATAAAGG - Intronic
1071260824 10:83917494-83917516 GGAGCAAAATCTAAGGCAAAGGG + Intergenic
1071282219 10:84113188-84113210 GCAGCATTATATAAGGAAAAAGG + Intergenic
1071395126 10:85215659-85215681 AGGGCATTATATAATGATAAAGG + Intergenic
1072020820 10:91398407-91398429 AGGTCATTATATAATGAAAAAGG + Intergenic
1073100665 10:101004766-101004788 TGAGGATTAAATAAGGCAAAAGG + Intronic
1073638745 10:105227777-105227799 AGATCATTATATAATGATAAAGG - Intronic
1073728350 10:106261041-106261063 GGAGCATCACATAATGATAAAGG + Intergenic
1073782474 10:106854184-106854206 GGGGCATTACATAATGATAAAGG - Intronic
1074049958 10:109872640-109872662 GGAAGATTATCCAAGGAAAAGGG - Intronic
1074440447 10:113473006-113473028 AGAGAAGTATAGAAGGAAAAAGG - Intergenic
1076002680 10:126924524-126924546 GGAGCCTTAAAAAAGGCAAACGG + Intronic
1077344915 11:2042407-2042429 GGAGAATGGAATAAGGAAAATGG - Intergenic
1077345490 11:2048191-2048213 GGAGTATTATATATGGACAATGG - Intergenic
1077589038 11:3477539-3477561 GGAGCATTATATAAAGAAAAGGG - Intergenic
1079523793 11:21360705-21360727 GGAACATTATATAAAGATGAAGG - Intronic
1079555812 11:21757589-21757611 AGGGCATTATATAATGATAAAGG - Intergenic
1079565931 11:21882434-21882456 AGATCATTATATAATGATAAAGG + Intergenic
1079849013 11:25506154-25506176 AGGGCATTATATGATGAAAAAGG - Intergenic
1079861014 11:25671064-25671086 GTAGCATTATATGAGTCAAAGGG - Intergenic
1080141903 11:28931720-28931742 GAAGCAACATATAAGTAAAAAGG - Intergenic
1080155329 11:29104298-29104320 GTAGCATTATATATGACAAATGG - Intergenic
1080821777 11:35814133-35814155 GGAGCATAATAAAAAGAAACTGG + Exonic
1080970847 11:37275044-37275066 GGGGCATTACATAATGATAAAGG - Intergenic
1081074069 11:38646785-38646807 GCAGCAATATAAAAGAAAAAAGG + Intergenic
1081244600 11:40748888-40748910 AGATCATTATATAATTAAAAAGG + Intronic
1081293933 11:41362327-41362349 GGAGGTTAATAAAAGGAAAAAGG + Intronic
1082865347 11:57895156-57895178 GCATCATTATATAATGATAAAGG - Intergenic
1083524901 11:63354110-63354132 GGAGCAGTAAATGAGGAAAGTGG - Intronic
1083529003 11:63399456-63399478 AGATCATTATATAATGATAAAGG + Intronic
1084227715 11:67727665-67727687 GGACCATGATAGAAAGAAAAGGG - Intergenic
1084244733 11:67849162-67849184 GGAGCATTATATAAAGAAAAGGG - Intergenic
1084261121 11:67979352-67979374 GGAGCGTGATAGAAAGAAAAGGG - Intergenic
1084766947 11:71317444-71317466 GAAGCATTAGATAATGATAAAGG - Intergenic
1084811527 11:71614743-71614765 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
1084841056 11:71848554-71848576 AGAGCATTACATAATGATAAAGG - Intergenic
1084844609 11:71889207-71889229 GGAGCGTGATAGAAAGAAAAGGG + Intronic
1084847460 11:71911665-71911687 GGAGCGTGATAGAAAGAAAAGGG + Intronic
1085063369 11:73469575-73469597 GGACCATCAGATAAGCAAAACGG + Intronic
1085217984 11:74848971-74848993 GGATCTTTATATAAGGTATAGGG - Intronic
1086036963 11:82427670-82427692 GGATCATTACATAATGATAAAGG + Intergenic
1086119158 11:83287413-83287435 GGATCATTAGATGAGGAAAGGGG - Intergenic
1086205068 11:84248476-84248498 GGAGCTTGATATGATGAAAATGG - Intronic
1086409718 11:86532131-86532153 AGATCATTATATAATGATAAAGG + Intronic
1087308379 11:96510402-96510424 AAAGCATTATATAAAGAAAGAGG + Intergenic
1087411834 11:97800565-97800587 GCAGCATTTTTTAAGAAAAATGG - Intergenic
1087460726 11:98443201-98443223 GGGTCATTATATAATGATAAAGG - Intergenic
1087610403 11:100427230-100427252 GGATTATTATATAAGGATAAAGG + Intergenic
1087631087 11:100650871-100650893 GGGACATTATATAATGAAAAAGG + Intergenic
1088240273 11:107767072-107767094 AGAGCATTATATAATAATAAAGG + Intergenic
1088515944 11:110633950-110633972 GGAGCACAAAATAAGAAAAAAGG + Intronic
1089174868 11:116540947-116540969 GGAGCACCATAGCAGGAAAAGGG - Intergenic
1090312939 11:125758309-125758331 AGGGCATTATATAAGGGTAAAGG + Intergenic
1090335597 11:125961126-125961148 GGAGCATTATCAAATGATAAAGG + Intronic
1090443443 11:126743525-126743547 AAAGCACTATATAAGGCAAATGG + Intronic
1090841649 11:130494472-130494494 GGGGCATTACATAATGTAAAGGG - Intergenic
1091116203 11:133015965-133015987 GGAGCCTTGGATATGGAAAAGGG - Intronic
1202827845 11_KI270721v1_random:97280-97302 GGAGAATGGAATAAGGAAAATGG - Intergenic
1091505435 12:1062938-1062960 GGGACATTATATAATGATAAAGG - Intronic
1092176816 12:6414861-6414883 GGGGCATTACATAATGATAAGGG - Intergenic
1092328533 12:7560613-7560635 GGAACAATATTCAAGGAAAAGGG - Intergenic
1092415297 12:8286307-8286329 GGAGCATTATATAAAGAAAAGGG - Intergenic
1092973343 12:13720054-13720076 GGAGCATGATAGAAACAAAACGG + Intronic
1093273812 12:17099019-17099041 GGAGCATTTTCTTTGGAAAAGGG - Intergenic
1093289294 12:17301598-17301620 GGGGCATTATACAAGGAAAAAGG + Intergenic
1093486044 12:19653713-19653735 TGAGTATTACAAAAGGAAAAGGG + Intronic
1093541830 12:20296966-20296988 AGGGCATTATATAATGATAAAGG - Intergenic
1093805416 12:23426716-23426738 AGAGCATTAGCTTAGGAAAAGGG - Intergenic
1094256576 12:28435839-28435861 GGAACATTACATAATGATAAAGG - Intronic
1094258828 12:28467364-28467386 AGGTCACTATATAAGGAAAAAGG + Intronic
1094657314 12:32432657-32432679 AGAGCATTATATACAGAGAAGGG + Intronic
1095051515 12:37558788-37558810 AGAGCACCATATAAGGAAAGTGG - Intergenic
1095516986 12:43016633-43016655 GGAGTAATTTATAAAGAAAAGGG - Intergenic
1095562072 12:43577094-43577116 GGAGTATTATATATGGAATAAGG + Intergenic
1096346595 12:50852749-50852771 AGAGCATTACATAATGATAAAGG + Intronic
1096509011 12:52116874-52116896 GGAGCATTATAGAAAGAAAACGG - Intergenic
1096577270 12:52560615-52560637 AGAGCATGACATCAGGAAAAAGG - Intergenic
1097602389 12:61709652-61709674 AAAGTATTATATAATGAAAATGG + Exonic
1097662221 12:62443527-62443549 AGGGCATTATATAATGATAAAGG - Intergenic
1097882747 12:64700856-64700878 GAAGTTTTATATAAGGATAAAGG + Intergenic
1097890818 12:64775533-64775555 GGGGCATTATATAATGGTAAAGG + Intergenic
1097932421 12:65203865-65203887 GGAGCATTACATAATGACAAAGG - Intronic
1098748639 12:74269047-74269069 GGAGCATTATATAAGGAAAAGGG + Intergenic
1098837045 12:75436028-75436050 AGATCATTATATAATGATAAAGG - Intergenic
1099128600 12:78797616-78797638 GTAGCATTATATATAAAAAATGG - Intergenic
1099732504 12:86523823-86523845 GGGGCATTAAATAATGATAAAGG - Intronic
1100932559 12:99626752-99626774 GGAGCAAGATATCAGGAAAGAGG + Intronic
1101254060 12:102959941-102959963 GAAGCATTCTATAATGAAAATGG - Exonic
1101599121 12:106193311-106193333 GCAGCCTTACCTAAGGAAAATGG - Intergenic
1101944108 12:109122853-109122875 GGGGAATAATATAGGGAAAATGG - Intronic
1104292907 12:127485566-127485588 GGGGCATTATACAAGGAAAAAGG + Intergenic
1104705581 12:130943943-130943965 GGGTCATTACATAAGGATAAAGG - Intergenic
1105343400 13:19549767-19549789 GGTGGATTTGATAAGGAAAATGG + Intergenic
1106042439 13:26105931-26105953 AGAGCATTATATAATGGTAAAGG + Intergenic
1106067876 13:26374565-26374587 AAAGCAATATATTAGGAAAATGG + Intronic
1107124004 13:36825033-36825055 ATAGCATTATATAAAGAGAATGG + Intronic
1107490506 13:40876642-40876664 GGAGCATTATATAAAGAAAAGGG - Intergenic
1107501585 13:40983764-40983786 GGATAATAATTTAAGGAAAAAGG - Intronic
1107544161 13:41421474-41421496 GGAGCGTGATAGAAAGAAAAGGG - Intergenic
1107734699 13:43386348-43386370 AGAGCATTATTTAAGGAGAATGG + Intronic
1108113968 13:47107996-47108018 GGATCCATATATAAGGAAAGAGG - Intergenic
1109243758 13:59927057-59927079 AGATCATTATATAATGATAAAGG - Intronic
1109584102 13:64375253-64375275 GGAGAATTACATTAGGAATAGGG + Intergenic
1109747904 13:66650381-66650403 AGAGCATTATATAATGATAAAGG + Intronic
1109802999 13:67401911-67401933 GGAGCATTATATAAGGAAAAGGG + Intergenic
1110702902 13:78570428-78570450 GGATTATTATAAATGGAAAATGG + Intergenic
1110916164 13:81023475-81023497 AGGGCATTATATAATGATAAAGG + Intergenic
1111064761 13:83075302-83075324 AGAGCATTATATAGGAATAAAGG + Intergenic
1111592444 13:90367680-90367702 GGAACAATATATAAGAAAATGGG - Intergenic
1111739899 13:92191122-92191144 GGGGCATTATATAGTGATAAAGG + Intronic
1113470249 13:110539477-110539499 GGAGAATTATTCCAGGAAAATGG + Intronic
1114343757 14:21773206-21773228 GGAGCATAAAAGAATGAAAAGGG - Intergenic
1114768270 14:25399419-25399441 GGAGCATTAAATAATTTAAATGG - Intergenic
1115012549 14:28566962-28566984 GGTGGATTGTATAAAGAAAATGG - Intergenic
1115065082 14:29249937-29249959 GGGGCATTAAATAATGATAAAGG - Intergenic
1115086141 14:29517163-29517185 TGAGTATGATATAATGAAAATGG + Intergenic
1115360685 14:32497870-32497892 GGATCATTTTATAATGATAAAGG - Intronic
1115534114 14:34356613-34356635 TGGGCAATTTATAAGGAAAAAGG - Intronic
1115911536 14:38261669-38261691 AGAGCATTACATAATGATAAAGG + Intergenic
1115919748 14:38359510-38359532 GGAGTAATTTATAAAGAAAAGGG + Intergenic
1115958021 14:38803635-38803657 AGAGCATAATATAATGATAATGG + Intergenic
1115974153 14:38978911-38978933 AGGGCATTATATAATGATAAAGG - Intergenic
1116324621 14:43516450-43516472 GGGACATTATGTAAGGTAAAAGG + Intergenic
1116613000 14:47102159-47102181 GGAGCATTTAATTATGAAAAAGG + Intronic
1116753923 14:48922043-48922065 GGAGCATAATAGAAGTAGAAGGG - Intergenic
1116781086 14:49238506-49238528 AGGGCATTATATAATGATAAAGG - Intergenic
1117842769 14:59878070-59878092 AGATCATTATATAATGATAAAGG - Intergenic
1118799924 14:69180360-69180382 GGAGAATTAAAAAGGGAAAATGG + Intergenic
1118951625 14:70440883-70440905 GGAGCTATATATAAGGAGAGAGG - Intergenic
1119946559 14:78701201-78701223 GGAGCATTCAATAAGGCAAAGGG + Intronic
1120545642 14:85808530-85808552 GGAGAAATATTTAAGGAAATAGG - Intergenic
1120608384 14:86608202-86608224 CTAGCTTTGTATAAGGAAAAAGG + Intergenic
1121153212 14:91656917-91656939 GGGTCATTATATAATGATAAAGG + Intronic
1124040335 15:26096144-26096166 GGAGAGTAACATAAGGAAAATGG + Intergenic
1124719595 15:32099857-32099879 GGCACATTTTATTAGGAAAATGG + Intronic
1124985845 15:34612171-34612193 GGAACTTTAAATAAAGAAAATGG + Intergenic
1126187229 15:45841953-45841975 GGAGCATTATGTCAGGAACCTGG + Intergenic
1126190760 15:45875717-45875739 GGGACATTATATAATGATAAAGG + Intergenic
1126490106 15:49227360-49227382 GGGGTATTATATAATGACAAAGG - Intronic
1126968281 15:54081523-54081545 AGAGTATTATATAATGATAAAGG - Intronic
1127096308 15:55515107-55515129 GGAGCATTATATAAGGAAAAGGG - Intergenic
1127137767 15:55942653-55942675 TGAGCAGTTTATAAAGAAAACGG - Intronic
1127286780 15:57539793-57539815 GGAGCAATATATAAAGAATAAGG - Intronic
1127681076 15:61299029-61299051 GGATCATCGTATAAAGAAAAGGG - Intergenic
1128176734 15:65562664-65562686 GGAGCATTCAGGAAGGAAAAAGG + Intronic
1128375214 15:67069456-67069478 TGAGCGTTATATGAGGAATAAGG + Intronic
1128461471 15:67871120-67871142 GGGGCATTACATAATGACAAAGG + Intergenic
1128719725 15:69939605-69939627 GGAGCCTTAGCTAATGAAAAGGG + Intergenic
1131351130 15:91700926-91700948 GAAGAAATAGATAAGGAAAATGG + Intergenic
1131627012 15:94131913-94131935 AGGGCATTATATAATGATAAAGG - Intergenic
1133605117 16:7379450-7379472 GGAGCTTTATATAAGAAGAATGG + Intronic
1135559743 16:23467043-23467065 GAAGCATTGTCTAATGAAAATGG + Exonic
1135704195 16:24660621-24660643 GGGGCATTTTATAATGACAAAGG - Intergenic
1135800667 16:25491980-25492002 GGAGCATTATGTAACGATACAGG - Intergenic
1137869521 16:51936211-51936233 GTAGCAATAGATAATGAAAATGG + Intergenic
1138151942 16:54666253-54666275 AGAGCATTATATAATGGTAAAGG - Intergenic
1138661643 16:58522403-58522425 GCAGCTTTATATAAACAAAATGG + Intronic
1138972810 16:62167289-62167311 AGGGCATTATATAATGATAAAGG - Intergenic
1139073264 16:63410543-63410565 GTAGTAATATATAAGGAATATGG - Intergenic
1139322781 16:66128970-66128992 GGAGATTTATTTAAGGAAGAAGG + Intergenic
1140621234 16:76735755-76735777 GAAGCATTATTTATAGAAAATGG - Intergenic
1140726850 16:77821255-77821277 GAAGGATTATATAAGGAATTAGG + Intronic
1140909491 16:79438473-79438495 GGAGAATTATGTAAGGAACGGGG + Intergenic
1141058940 16:80846227-80846249 AGATCATTATATAATGATAAAGG + Intergenic
1141071284 16:80957043-80957065 AGGGCATTACATAATGAAAAGGG + Intergenic
1143555550 17:7657537-7657559 GCAGCATTAAAAAAAGAAAAAGG - Exonic
1144822590 17:18085876-18085898 GGAACATTTTATAAGGCAATTGG - Intergenic
1145372153 17:22315688-22315710 AGAGCACCATATAAGGAAAGTGG - Intergenic
1145944327 17:28761577-28761599 TGAGCATATTAGAAGGAAAATGG + Intronic
1146086298 17:29833321-29833343 GGACTATTATATAATGATAAAGG - Intronic
1148569090 17:48653021-48653043 AGAGCATTACATAATGACAAAGG - Intergenic
1149076123 17:52597500-52597522 GGGGCATTATACAAGGAAAAAGG + Intergenic
1149131116 17:53303365-53303387 AGGGCATTATATAATGATAAAGG + Intergenic
1149232452 17:54551182-54551204 AGATCATTATATAATGATAAAGG - Intergenic
1149414046 17:56439646-56439668 GGAGCAGTATATAAGGCATTAGG + Intronic
1150970951 17:70027682-70027704 AGGGCATTATATAATGATAAAGG - Intergenic
1151101521 17:71561463-71561485 GGAGTATTTCATAAGGGAAAAGG + Intergenic
1152062902 17:78092225-78092247 GAAGCATTCTAAAAAGAAAAAGG + Intronic
1153798257 18:8644859-8644881 GGAGCATTATATAATAATAAAGG + Intergenic
1154392803 18:13955643-13955665 AGAGCATTACATAATGATAAAGG + Intergenic
1155411092 18:25546017-25546039 AGGACATTATATAATGAAAAAGG + Intergenic
1155831958 18:30527215-30527237 AGAGCGTTATATAATGATAATGG - Intergenic
1156691807 18:39716149-39716171 GGAAGATTATATAAGGCAAAAGG + Intergenic
1156939366 18:42746492-42746514 AGAGCATTATTTGAGTAAAAGGG + Intronic
1157329345 18:46692124-46692146 GGAGAATCATACAAGGAGAAGGG + Intronic
1157365129 18:47057861-47057883 GGAGCATTAGACCAGGAGAAAGG - Intronic
1157827751 18:50827790-50827812 GAAGCATTATAAAAAGAATATGG + Intergenic
1157919910 18:51704352-51704374 AGACCATTATATAATGGAAAAGG - Intergenic
1157968650 18:52239531-52239553 GTAGCATGTTATAAGGCAAAAGG - Intergenic
1158081675 18:53599936-53599958 AGAGCATTTTAGAAAGAAAATGG + Intergenic
1158146190 18:54315689-54315711 AGGGCATTATATAATGACAAAGG - Intronic
1158151811 18:54382506-54382528 GGAGCACTATTTTGGGAAAATGG + Intronic
1158300489 18:56046782-56046804 GGAGAACTATGTAAGGAAGAGGG - Intergenic
1158822390 18:61176315-61176337 AGAGCATTACATAATGATAAGGG + Intergenic
1158844401 18:61426411-61426433 GAAGGATTATAGGAGGAAAATGG + Intronic
1159230225 18:65597645-65597667 GAAGCATTATATTAAGTAAAAGG + Intergenic
1159543258 18:69807700-69807722 AGATCATTATATAATGACAATGG + Intronic
1162251605 19:9448935-9448957 AGAGCACTATATAATGATAAAGG + Intergenic
1162284208 19:9726128-9726150 GGAGCATTATATAAGGAAAAGGG - Intergenic
1162288479 19:9759782-9759804 TGAAAATTATATGAGGAAAATGG - Intronic
1163356785 19:16817925-16817947 GTAGCATTTTATTAGTAAAAAGG - Exonic
1163897262 19:20070098-20070120 GGGACATTATATAATGATAAAGG + Intergenic
1163916786 19:20247081-20247103 AAAGCATTATATAAAGAAACAGG + Intergenic
1163943212 19:20513842-20513864 GGAGCATTATATAAGGAAAAGGG - Intergenic
1163949200 19:20568444-20568466 GTAGCATCATATAATGGAAATGG + Intronic
1163966376 19:20750834-20750856 GGAGCATTATGTAAAGAAAAGGG - Intronic
1164481050 19:28611250-28611272 GGGGCATTATACAAGGAAAAAGG + Intergenic
1166604041 19:44124749-44124771 GGGACATTATATAATGTAAAAGG - Intronic
1167942601 19:52959675-52959697 AAAGCATTATATAAAGAAAAGGG + Intronic
1168673332 19:58258123-58258145 GGAGCATGAAATGAGGAAAGGGG - Intronic
925441716 2:3893349-3893371 TGGACATTATATAAGGATAAAGG - Intergenic
926877959 2:17506127-17506149 GGGGAATTATAAAAGTAAAAAGG + Intergenic
927298493 2:21483358-21483380 AGGGAATTATACAAGGAAAAGGG - Intergenic
927363290 2:22262840-22262862 GGGACATTATATAATGATAAAGG - Intergenic
928354653 2:30599683-30599705 AGGGCATTATATAATGATAAAGG - Intronic
928813984 2:35267083-35267105 GGAGAATTATCTAAGGAAGAGGG - Intergenic
929186576 2:39101733-39101755 CCAGCAGTATATAGGGAAAAAGG + Intronic
929353123 2:40984759-40984781 GGGGCATTATATAATGATAAAGG - Intergenic
929377081 2:41300191-41300213 GCAGCTTTAGATAAGGGAAAGGG + Intergenic
929852785 2:45608166-45608188 GGAGCCTTCTTTAAGGATAATGG - Intronic
930253454 2:49061463-49061485 GGGACATTATATAATGATAAAGG + Intronic
930513641 2:52378650-52378672 AGGGCATTATATAATGATAAAGG - Intergenic
930518548 2:52435503-52435525 GGGGCGTTATATAAAGAAAAAGG + Intergenic
930589275 2:53307843-53307865 GTAACATTTTATATGGAAAAAGG - Intergenic
930887607 2:56345289-56345311 GTAGCATTACAAAAGAAAAATGG + Intronic
931194071 2:60033938-60033960 GGATCATTTTATAATGATAAAGG - Intergenic
932349942 2:71023589-71023611 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
932353437 2:71049727-71049749 AGAGGATTATAGAAAGAAAAGGG + Intergenic
932402791 2:71493413-71493435 GGAACATTCTATTAGAAAAAAGG - Intronic
932913037 2:75824757-75824779 AGAGCATTATATAATGGTAAAGG + Intergenic
933129733 2:78657225-78657247 AGAGCATTACATATGGTAAAGGG + Intergenic
933148101 2:78881026-78881048 GGAATATTATATAAGGTACATGG - Intergenic
933399422 2:81774677-81774699 GGAACATTACATAATGATAAAGG - Intergenic
933428484 2:82144144-82144166 GGAGAATCAGATAAGGAACAAGG + Intergenic
933574171 2:84048070-84048092 GGGGCATTACATAATGATAAAGG + Intergenic
934128621 2:88924182-88924204 AGAGCATTACATATGAAAAAGGG + Intergenic
935316867 2:101843484-101843506 GGAGCACTGTATGACGAAAAAGG + Intronic
935384298 2:102485022-102485044 TGAGGCTTAAATAAGGAAAATGG - Intronic
935989882 2:108709679-108709701 AGATCATTATATAATGAAAAAGG + Intergenic
936693082 2:114915265-114915287 AGAGCATTACATAATGATAAAGG + Intronic
937561410 2:123229276-123229298 GGGACATTATATAATGATAAAGG - Intergenic
939098071 2:137858986-137859008 GGATGATTAGATAAAGAAAATGG - Intergenic
939109947 2:137994428-137994450 AGGGCATTACATAAGGTAAAGGG + Intronic
939247324 2:139642855-139642877 AGGGCATTACATAAGGATAAAGG - Intergenic
939751303 2:146050693-146050715 TGAGCATTATATAAGCATAGGGG - Intergenic
940084015 2:149837844-149837866 AGGGCATTATATAATGGAAAAGG - Intergenic
940238132 2:151532578-151532600 TGAGGATCATATAAGGACAAAGG + Intronic
940535322 2:154934205-154934227 AGAACATTATATAATGATAAAGG - Intergenic
940577686 2:155532610-155532632 TGAAGATTATAAAAGGAAAACGG + Intergenic
940732295 2:157406824-157406846 GGAACATTATATAATGATAAAGG - Intergenic
940869522 2:158848366-158848388 GGAGCGTGATAGAAAGAAAAGGG + Intronic
940872198 2:158869364-158869386 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
940874405 2:158885352-158885374 GGAGCATGATAGAAAGAAAAGGG + Intergenic
941092000 2:161187476-161187498 GGGACATTATATAATGATAATGG + Intronic
941110646 2:161416428-161416450 AGAGCATGATAGAAGGAGAAAGG - Exonic
941706811 2:168667525-168667547 AGAGCTTTATATAAGAAAAGAGG - Intronic
941755394 2:169180063-169180085 GGAGCATTAGAGATGAAAAAAGG - Intronic
941780810 2:169442419-169442441 AGGGCATTACATAAAGAAAAAGG - Intergenic
941815210 2:169789258-169789280 GGGGCATAATATAAGGCAGATGG - Intergenic
942011711 2:171769671-171769693 GGGGCATTATATAATGATAAAGG + Intergenic
942743830 2:179209128-179209150 GGGGCATTATATAATGATACAGG + Intronic
943190240 2:184667570-184667592 GCAGGATTACATAATGAAAAGGG + Intronic
943866821 2:192935647-192935669 AGGGCATTATATAATGACAAAGG - Intergenic
944102162 2:196038791-196038813 AGGTCATTATATAATGAAAAGGG + Intronic
944779819 2:203006588-203006610 GGACCATTACATAATGATAAAGG + Intronic
945526227 2:210890682-210890704 AGGGCATTATATAATGATAAAGG + Intergenic
946042021 2:216790852-216790874 GCAGCACTTTAAAAGGAAAATGG - Intergenic
946100881 2:217321372-217321394 GGAAAGTTATATTAGGAAAAAGG - Intronic
946166725 2:217869038-217869060 GGAGGGTTATCAAAGGAAAAGGG + Intronic
947413669 2:229870616-229870638 CAAGCATTTTAAAAGGAAAATGG + Intronic
947465870 2:230345232-230345254 GGGTCAATATATAAGGATAAAGG - Intronic
947594999 2:231405510-231405532 GAAGCATCATATAAAGAAAAGGG + Intergenic
947950115 2:234139624-234139646 GGGGCATTAAAGAAGGAAAGAGG + Intergenic
948486286 2:238283357-238283379 GTAGCAGTAGAAAAGGAAAAGGG - Intronic
949082112 2:242110318-242110340 GTAGCTTTATATCAGGAAAATGG + Intergenic
1169025350 20:2366093-2366115 AGGGCATTTTATAAGGACAAGGG - Intergenic
1169659718 20:7964834-7964856 GGAGGATTTTACAAGGAAACTGG - Intergenic
1169916118 20:10685662-10685684 GGAGGATGAGCTAAGGAAAAAGG + Intergenic
1170416734 20:16151334-16151356 AGGGCATTATATAATGATAAAGG + Intergenic
1170543070 20:17408235-17408257 GGAGAATGAGATGAGGAAAAAGG + Intronic
1171384375 20:24758801-24758823 GGTGCATTATATAATGATAAAGG + Intergenic
1171408543 20:24930228-24930250 GGAGCGTTATATAAAGAAAAGGG + Intergenic
1171546049 20:26002314-26002336 AGAGCATCATATAAGGAAAGTGG - Intergenic
1172508230 20:35479916-35479938 GGAGAATTTTATTAGGTAAAAGG + Intronic
1173091095 20:39972875-39972897 AGAGCATTATATAATGGTAAAGG - Intergenic
1173934046 20:46845824-46845846 TGAGTAATATATAAAGAAAAGGG + Intergenic
1175345907 20:58275522-58275544 GGAGCATTATTAAAGGAATGAGG + Intergenic
1177099409 21:16881217-16881239 AGTGCATTACATAAGGTAAAGGG + Intergenic
1177721922 21:24918326-24918348 AGGGCATTATATAATGATAAAGG - Intergenic
1178286033 21:31326201-31326223 GGGGCATTCTATAAGAAAAATGG - Intronic
1178447713 21:32660775-32660797 GGAGCATTATATAAGGAAAAGGG + Intronic
1178834952 21:36089010-36089032 GAAGCTTTATAAGAGGAAAAGGG + Intergenic
1179121669 21:38552077-38552099 AGGGCATTATATAATGATAAAGG - Intronic
1179278806 21:39916321-39916343 GAAATATTATATAAAGAAAAGGG - Intronic
1180254229 21:46612314-46612336 GGAGCATTACATAATGACAAAGG - Intergenic
1182086905 22:27567278-27567300 ATAGTATCATATAAGGAAAATGG - Intergenic
1185007876 22:48294900-48294922 GGGGCATTACATAACGACAAAGG + Intergenic
949145392 3:693321-693343 AGAGCATTACATAATGATAAAGG + Intergenic
949158114 3:851137-851159 GGGGCATTGTATAAAGAAAAAGG + Intergenic
949687737 3:6596973-6596995 AGGGCATTATATAATGATAAAGG - Intergenic
949884560 3:8682950-8682972 GGAGCGTGATAGAAAGAAAAAGG + Intronic
950341903 3:12254446-12254468 GGAACAATAGATATGGAAAAAGG + Intergenic
951122783 3:18947885-18947907 AGAGCATTAAAAAAGAAAAAAGG - Intergenic
951166013 3:19485902-19485924 GGAGCATTATACAAGAAAAAGGG - Intronic
951223300 3:20092657-20092679 AGGGCATTATATAATGATAAAGG - Intronic
951646081 3:24892556-24892578 TGAGCATTTTATAAAGAGAATGG + Intergenic
951758711 3:26120638-26120660 GGGGTATTATGTAATGAAAAAGG + Intergenic
951843108 3:27056208-27056230 AGAGCATTACATAATGATAAAGG - Intergenic
951965224 3:28375064-28375086 GGATCATTATATAATGATAAAGG - Intronic
952549338 3:34458257-34458279 AGATCATTATATAATGATAAAGG - Intergenic
952693383 3:36236865-36236887 GGTGGATTAAATAAAGAAAATGG + Intergenic
953642230 3:44719426-44719448 GCAGCATTATTCAAGGAAAAAGG - Intronic
954509398 3:51108788-51108810 AGAGCATTATATAATGGTAAAGG + Intronic
955002547 3:54940554-54940576 GCTGCATTATATAAAGACAAGGG - Intronic
955622644 3:60881203-60881225 GGATCATCATATAATGATAAAGG + Intronic
956062943 3:65366693-65366715 AGAGAATTATCTAAGGAAATTGG + Intronic
957022497 3:75140939-75140961 GGGGCATTATACAAGGAAAAAGG + Intergenic
957076188 3:75604913-75604935 GGAGCATGATAGAAAGAAAAGGG - Intergenic
957394965 3:79624602-79624624 AGGGCATTATATAATGGAAAAGG + Intronic
957526282 3:81382451-81382473 AGATCATTATATAATGATAAAGG + Intergenic
957807989 3:85176071-85176093 GGAGCATTAGAAGAGGGAAATGG + Intronic
958506998 3:94992627-94992649 GGAGCAGAATGTCAGGAAAAGGG + Intergenic
958544631 3:95528545-95528567 AGGGCATTATATAATGATAAAGG - Intergenic
958602874 3:96321308-96321330 GGAGAATTTTCTAAGGAGAAAGG - Intergenic
958638235 3:96773352-96773374 AGGCCATTATATAATGAAAAAGG + Intergenic
958722194 3:97857586-97857608 AGGCCATTATATAAGGATAAAGG - Intronic
959115392 3:102171640-102171662 GGGGCATTATAAAGGGAAATGGG - Intronic
959195659 3:103177941-103177963 AGATCATTATATAACAAAAATGG + Intergenic
959699790 3:109288014-109288036 GAATCTTTATATTAGGAAAAGGG - Intergenic
959830624 3:110857522-110857544 GGAGCATGAGATAAGTACAAAGG - Intergenic
960468452 3:118028786-118028808 AGATCATTATACAATGAAAAAGG - Intergenic
960509461 3:118531010-118531032 GGAGGATTATTCATGGAAAAGGG + Intergenic
961275111 3:125720269-125720291 GGAGCATGATAGAAAGAAAAGGG + Intergenic
961610854 3:128136815-128136837 AGATCATTATATAATGATAAAGG + Intronic
961876386 3:130026764-130026786 GGAGCATGATAGAAAGAAAAGGG - Intergenic
961892847 3:130144921-130144943 GGAGCATTATATAAAGAAAAGGG - Intergenic
961977783 3:131044526-131044548 GGGGCATTACATAATGTAAAGGG + Intronic
962064992 3:131970157-131970179 AGAGCATTAGAAAAGGGAAATGG - Intronic
962261118 3:133907588-133907610 GGAGTATTATATAAATTAAAAGG - Intergenic
962333538 3:134503739-134503761 AGGTCATTATATAATGAAAAGGG - Intronic
963237417 3:142969283-142969305 GCAGCATCCTATAAAGAAAAGGG - Intronic
963274620 3:143317686-143317708 TGAGAAATACATAAGGAAAATGG - Intronic
963464111 3:145656333-145656355 AGACCATTATATAATGATAAAGG - Intergenic
964142280 3:153417731-153417753 AGAGCATTACATAATGATAAAGG - Intergenic
964202880 3:154137911-154137933 GCAGCATTATCTATGGAGAAGGG - Intronic
964522399 3:157583209-157583231 GGAGCATTATATAAGGAAAAGGG - Intronic
964940307 3:162152471-162152493 AAAGCATTATATAATGATAAAGG - Intergenic
965074376 3:163957927-163957949 GGAGCATTTTTTAAGATAAAAGG - Intergenic
965526815 3:169729162-169729184 AGGTAATTATATAAGGAAAAGGG - Intergenic
966081159 3:176003271-176003293 GGATCAATATACAAGCAAAATGG - Intergenic
967301177 3:188015179-188015201 GGAACATTATATAATGATAAAGG - Intergenic
968417500 4:452885-452907 GCAGCATTATAAAATGGAAATGG + Intronic
968792356 4:2675480-2675502 GGAGCATTACATAATGAAAAAGG - Intronic
969019638 4:4131213-4131235 GGAGCATGATAGAAAGAAAAGGG - Intergenic
969734213 4:8976195-8976217 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
969749916 4:9102220-9102242 GGAACATTATATAAAGAAAAGGG + Intergenic
969782153 4:9414580-9414602 AGAGCATTACATAATGACAAAGG - Intergenic
969789063 4:9479491-9479513 GGAGCATGATAGAAAGAAAAGGG + Intergenic
969793800 4:9510259-9510281 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
970629798 4:17927859-17927881 CGAGCACGTTATAAGGAAAACGG + Intronic
970633881 4:17985503-17985525 AGAGCATTAAATAAGGGTAAAGG - Intronic
971141195 4:23926682-23926704 AGAGAGTTAGATAAGGAAAAAGG - Intergenic
971898697 4:32630188-32630210 GCATCATTATATAATGAGAAAGG + Intergenic
972044141 4:34641931-34641953 AGGGCATTATATAATGATAAAGG + Intergenic
972874398 4:43340655-43340677 GCAGCAATATATAACTAAAATGG - Intergenic
972927077 4:44022854-44022876 GGAGAAAGAAATAAGGAAAAAGG - Intergenic
974390972 4:61267624-61267646 GAATCATGATATCAGGAAAAGGG - Intronic
976073358 4:81268554-81268576 AGGTCATTATATAATGAAAAAGG - Intergenic
976158257 4:82171111-82171133 GGAAAATTATAAAAGAAAAAGGG - Intergenic
976722447 4:88182156-88182178 AGACCATTATATAATGATAAAGG + Intronic
976970030 4:91093011-91093033 GGAGCATTATATAAAGAAAAAGG - Intronic
977004458 4:91547433-91547455 GGAGCACTACATAAAGATAAAGG - Intronic
977346746 4:95825328-95825350 GGAGCAATATAAAGGGAGAAAGG - Intergenic
977589584 4:98811900-98811922 GGAGCATTACATAATGATAAAGG - Intergenic
977841886 4:101716911-101716933 AGATCATTATATAATGATAAAGG + Intronic
977897585 4:102382049-102382071 AGAGCATTAAATAATGGAAAGGG - Intronic
978030142 4:103931349-103931371 GGATCATTTTACAAGGATAAAGG - Intergenic
978950874 4:114557362-114557384 GTAGCTTTATACAAGGAAATTGG + Intergenic
978953777 4:114592290-114592312 GGAGCCATATATAAGGAAAGAGG - Intergenic
979012903 4:115394110-115394132 GGAGCATAAAATAATGATAATGG - Intergenic
979664035 4:123291029-123291051 GGGTCATTATATAATGATAAAGG - Intronic
979968737 4:127108238-127108260 AGGGCATTATATAATGATAAAGG + Intergenic
980275784 4:130648611-130648633 AGACCATAATATAATGAAAATGG + Intergenic
980302111 4:131008843-131008865 GTAGCTTTATACAAGGAAATTGG + Intergenic
980780147 4:137483045-137483067 GGAGCATTATATAAGGAAAAGGG + Intergenic
981591155 4:146363270-146363292 AGGTCATTATATAAGGATAAAGG + Intronic
982130425 4:152224274-152224296 GGAGAATTAGAGAAGGCAAAAGG + Intergenic
982639786 4:157944173-157944195 GGAGCATGATCTGAGGAAATGGG + Intergenic
983683756 4:170383193-170383215 AGATCATTATATAATGATAAAGG - Intergenic
983899220 4:173115287-173115309 AGAGCATTACATAATGATAAAGG + Intergenic
984303800 4:177960533-177960555 GGGGCATAGTATAGGGAAAAGGG + Intronic
984543527 4:181070759-181070781 GCAGCTTTATAAAAGAAAAACGG + Intergenic
984547453 4:181124079-181124101 TGTACATTATAAAAGGAAAAAGG - Intergenic
984854220 4:184179279-184179301 GGGGCATTATATAATGGTAAAGG + Intronic
985340471 4:188947163-188947185 TGGGCATTATATAACTAAAAAGG - Intergenic
986966327 5:13276382-13276404 GGAGCATTAAATAACCAAAAGGG + Intergenic
987726368 5:21705030-21705052 TAAGGATTATATAAGGAAGAAGG + Intergenic
987961829 5:24820445-24820467 GGGGCATTATATAATGATAAAGG + Intergenic
988034294 5:25805940-25805962 AGAGTATTATATAATGATAAAGG - Intergenic
988059731 5:26150926-26150948 AGAGCATTCCATAAGGATAAAGG + Intergenic
988374821 5:30423168-30423190 TGAGCATTATATAATGATAAAGG - Intergenic
988879830 5:35489524-35489546 GTATAATTATATAAGGAAAGTGG - Intergenic
989465933 5:41755646-41755668 GAAGAATTATAAAAGGTAAATGG - Intronic
989555269 5:42787687-42787709 AGGGCATTATATAATGATAAAGG - Intronic
990035760 5:51317290-51317312 AGGGCATTATATAATGATAAAGG - Intergenic
990499639 5:56383051-56383073 GGGGCATTATGTAATGACAAAGG + Intergenic
990536507 5:56728735-56728757 GGACCAATATAATAGGAAAAAGG - Intergenic
991420297 5:66434283-66434305 GGGGCATTAAATAATGAAAAAGG + Intergenic
991614407 5:68481192-68481214 GCACCTTTATATAAGGAGAAAGG - Intergenic
992085962 5:73278651-73278673 GGACATTTATATTAGGAAAATGG - Intergenic
992377075 5:76198521-76198543 GGGGCAGTTTATAAAGAAAAGGG - Intronic
992900453 5:81289714-81289736 AGGGCATTATATAATGATAAAGG + Intergenic
993023007 5:82614494-82614516 GGAGCATTACCTAATGAAAAAGG + Intergenic
993320471 5:86463340-86463362 GGGGCATTATACAAGGAAAAAGG + Intergenic
993682075 5:90891527-90891549 GGAGCATAATAGGAGCAAAAAGG + Intronic
993786315 5:92142362-92142384 AGAGCATTGTATAAATAAAATGG - Intergenic
994644133 5:102448606-102448628 GGGGCATTATATAATGACAAAGG - Intronic
995171779 5:109122800-109122822 AGGTCATTATATAATGAAAAAGG - Intronic
995238629 5:109859675-109859697 GGACCATTATTTAAGAAGAAGGG + Intronic
995855005 5:116581739-116581761 GGACCATTTAAAAAGGAAAAGGG + Intergenic
996519078 5:124406341-124406363 GGACCATTATAAAAGAAAATAGG + Intergenic
997535893 5:134621034-134621056 GCAGGATTATATAAGAAAACTGG - Exonic
998180407 5:139934829-139934851 GGGTCATTTTATAATGAAAAAGG + Intronic
998614459 5:143725092-143725114 AGAGCATTACATAATGATAAAGG - Intergenic
999699073 5:154211539-154211561 GCAGCACTATATAACCAAAACGG - Intronic
1000156828 5:158560476-158560498 GCAGCATTATAGACCGAAAAAGG - Intergenic
1000523752 5:162329634-162329656 AGGGCATTACATAAGGATAAAGG + Intergenic
1001590670 5:172862513-172862535 GGAGAATTCTTCAAGGAAAAGGG - Intronic
1001648352 5:173298420-173298442 GGAGGATTAGAAAAGGAGAAAGG + Intergenic
1001736672 5:174010079-174010101 AGGGCATTATATAATGATAAAGG - Intergenic
1001757039 5:174178497-174178519 GGAGGTTTATATCAGCAAAAAGG - Intronic
1003262172 6:4528079-4528101 AGATCATTATATAATGATAAAGG + Intergenic
1004057678 6:12157040-12157062 GGAGCATTACATAATGATATAGG - Intronic
1004310229 6:14539116-14539138 AGAGCATTACAGAAGGAAAGGGG - Intergenic
1004461656 6:15842243-15842265 GGAGCTGTACATAAGGAAACTGG + Intergenic
1006178405 6:32138094-32138116 GGAGCAGTAAATAAGGAACTAGG + Intergenic
1006240885 6:32677814-32677836 AGAGCATTATATAATGGTAAAGG - Intergenic
1006863398 6:37188760-37188782 GGAGCATTTTATATATAAAATGG - Intergenic
1008314899 6:50027548-50027570 AGGTCATTATATAAGGATAAAGG + Intergenic
1008349799 6:50476857-50476879 GGGGCATTACATAATGATAAAGG + Intergenic
1008583085 6:52923736-52923758 GGAGAATTATATAAAGAAAAGGG + Intergenic
1008719794 6:54335006-54335028 GCAGCATTATTTAAGAAAAGAGG + Intronic
1008916452 6:56792761-56792783 GGGACATTATATAAGACAAATGG + Intronic
1009494544 6:64331223-64331245 GGAGCCATATACAAGGAAAGAGG + Intronic
1009638103 6:66293068-66293090 TGAGAATTATATAGGCAAAAGGG - Intergenic
1010045505 6:71438298-71438320 GGGACATTATATAATGATAAAGG + Intergenic
1010054371 6:71547234-71547256 GGAGCATTACATAATGATACAGG + Intergenic
1010087816 6:71941081-71941103 ACATCATGATATAAGGAAAAAGG - Intronic
1010276729 6:73976756-73976778 AGAGCATTACATAATGATAAAGG - Intergenic
1011301222 6:85876637-85876659 AGAGCATTATATAATGGTAAAGG - Intergenic
1011565347 6:88666926-88666948 GGGGCATTATACAAAGAAAAAGG + Intronic
1011886807 6:92107073-92107095 AGGGCATTATATAATGATAAAGG - Intergenic
1012135130 6:95546006-95546028 TTAGCATTATAGAAGGAAATAGG + Intergenic
1012611693 6:101227151-101227173 GGGGTGTTATATAAAGAAAAAGG - Intergenic
1012843459 6:104360203-104360225 AGAGAATTATATATGGAAGAAGG - Intergenic
1013046038 6:106486658-106486680 AGATCATTATATAATGATAAAGG - Intergenic
1013763502 6:113546706-113546728 AGATCATTATATAATGATAAAGG + Intergenic
1014132347 6:117848601-117848623 AGGGCATTATATAATGATAAAGG + Intergenic
1015117173 6:129662416-129662438 GGAGCATAATTTAAGGCAAGAGG - Intronic
1015811563 6:137166347-137166369 GGAGCCATATATAAGGAAAGAGG + Intronic
1015852785 6:137591341-137591363 AAAGCATTATATAATGATAAAGG + Intergenic
1016327267 6:142916529-142916551 GGAGCATTAAATAAGTGAAGGGG - Intronic
1016572235 6:145527521-145527543 AGGGCATTATATAATGATAAAGG - Intronic
1017258365 6:152360065-152360087 GGAGCATGAAATAAGGGACAGGG - Intronic
1017536898 6:155356755-155356777 GAAGATTTATGTAAGGAAAATGG + Intergenic
1017542859 6:155421105-155421127 GGAGCAATATTTTAGGAAGACGG - Intronic
1018097446 6:160402293-160402315 CGGGCATTATATAATGACAAAGG + Intronic
1019031378 6:169016397-169016419 GGAGCATTACATAATGGTAAAGG - Intergenic
1020307025 7:6843240-6843262 GGAGCATGCTAGAAAGAAAAGGG - Intergenic
1020311501 7:6872084-6872106 GGAGCGTGATAGAAAGAAAAGGG - Intergenic
1020323069 7:6954422-6954444 GGAGCATTATATAAAGAAAAGGG - Intergenic
1020694339 7:11395226-11395248 AGAGCATTACATATGGTAAAGGG + Intronic
1021043838 7:15896769-15896791 AGAACATTATATAATGATAAGGG + Intergenic
1021215920 7:17915126-17915148 AGAGCATTATATTATGATAAAGG + Intronic
1021318733 7:19184588-19184610 AGGTCATTATATAATGAAAAAGG + Intergenic
1022152355 7:27621136-27621158 AGGGCATTAAATAATGAAAAAGG + Intronic
1022381727 7:29866734-29866756 GGGGCATCAGAGAAGGAAAAGGG - Intronic
1022779478 7:33564353-33564375 GGGGCATTATATATGGAGACAGG + Intronic
1022898728 7:34780567-34780589 GGAGCATTTATTCAGGAAAATGG + Intronic
1024468969 7:49747359-49747381 GGCACATTACATAAGGAGAATGG + Intergenic
1024842784 7:53605851-53605873 GGGGCATTATGTAATGATAACGG + Intergenic
1025211854 7:57023982-57024004 GGAAGATCATATAAGTAAAAAGG - Intergenic
1025660101 7:63552846-63552868 GGAAGATCATATAAGTAAAAAGG + Intergenic
1025823761 7:64994695-64994717 GGAGCTATATATAAAGAAAGAGG - Intronic
1027622355 7:80505119-80505141 GGAGAAGTGTATCAGGAAAATGG + Intronic
1027757219 7:82229308-82229330 GGAGCATTATGCAGGGAACAAGG - Intronic
1028261875 7:88676180-88676202 GGGACATTATATAATGATAAAGG + Intergenic
1028856752 7:95601643-95601665 GGAGCCTTGTATAAAGAAACTGG - Intergenic
1028915704 7:96256472-96256494 AGGGCATTATATAATGATAAAGG + Intronic
1029078179 7:97952184-97952206 GGAGCATGCTAGAAAGAAAAGGG - Intergenic
1030094231 7:105883727-105883749 GGAGCATTAATTAAGGAAATGGG - Intronic
1030769297 7:113454376-113454398 GGAGCAGTAGAGAAGGACAAGGG - Intergenic
1031148003 7:118018536-118018558 GGGACATTATATAATGATAAAGG + Intergenic
1031169252 7:118271701-118271723 GGGACATTATATAATGACAAAGG - Intergenic
1031296140 7:120006749-120006771 GGATCATTATATAATGATAAAGG - Intergenic
1031675822 7:124610573-124610595 GAAGTAGTATACAAGGAAAAAGG - Intergenic
1031696629 7:124864191-124864213 GGAGCATTTCATAAGGACAAAGG - Intronic
1031812322 7:126386544-126386566 AGGACATTATATAATGAAAAAGG + Intergenic
1032170772 7:129582825-129582847 GGTGCATTATTCAAGGAAAAAGG + Intergenic
1032313757 7:130814600-130814622 GGAGCAAGATATAAGGGATATGG - Intergenic
1032670197 7:134075385-134075407 TGAGTAGTTTATAAGGAAAAAGG + Intergenic
1033109371 7:138561046-138561068 GGAGCTATATATAAGGAAAGAGG - Intronic
1033567163 7:142589972-142589994 TGATCATTAGAAAAGGAAAATGG - Intergenic
1034001794 7:147421906-147421928 GGAGCTTTACTTATGGAAAAAGG - Intronic
1034025248 7:147695912-147695934 GGAGCATTACATAATGATAAAGG - Intronic
1034026051 7:147705786-147705808 AGATCATTATATGATGAAAAAGG - Intronic
1034325883 7:150232103-150232125 GGTGCATTACATAACGATAAAGG - Intergenic
1034767327 7:153737154-153737176 GGTGCATTACATAACGATAAAGG + Intergenic
1035014105 7:155749224-155749246 GAAGCATTCTACAAAGAAAATGG - Intronic
1035347947 7:158218838-158218860 GGGGCTTTACATAATGAAAAAGG + Intronic
1035540027 8:427029-427051 GTAGCTTTATATCAGGAAAATGG + Intronic
1035653368 8:1285996-1286018 GGTGAATTATAAAAGAAAAATGG - Intergenic
1035753788 8:2015231-2015253 GGGTCATTATATAATGACAAAGG - Intergenic
1036239829 8:7072319-7072341 GGAGCATTCTAGAAAGAGAAGGG + Intergenic
1036372995 8:8176560-8176582 GGAACATTATATAAAGAAAAGGG + Intergenic
1036816610 8:11907299-11907321 GGAGCGTGATAGAAAGAAAAGGG - Intergenic
1036857043 8:12304683-12304705 TGAGTAATTTATAAGGAAAAAGG - Intergenic
1036877910 8:12489081-12489103 GGAACATTATATAAAGAAAAGGG - Intergenic
1036903504 8:12689246-12689268 GGAGCGTGATAGAAAGAAAAGGG - Intergenic
1036906004 8:12708925-12708947 GGAGCATGATAGAAAGAAAAAGG - Intergenic
1037180233 8:15996076-15996098 GTACCTTTATATAAGAAAAAAGG - Intergenic
1037377374 8:18245444-18245466 GGATCATTATGTAATGACAAAGG + Intergenic
1037791005 8:21941661-21941683 GGCCAATTATATAAGGAAATGGG + Intronic
1038799124 8:30733368-30733390 GGAGCATTATATAAAGAAAAGGG + Intronic
1039278384 8:35956268-35956290 GGGGCATTATACAAGGAAAAAGG + Intergenic
1039430928 8:37524581-37524603 AGCTCATTATATAAGGGAAATGG - Intergenic
1039641594 8:39228448-39228470 GGAGAATTATTCAAGGAAATAGG + Intronic
1039642558 8:39239832-39239854 GGGGCATTATATAATGATAAAGG + Intronic
1039644423 8:39265234-39265256 AGAGCATTACATAATGATAAAGG - Intronic
1040063384 8:43123782-43123804 AGATCATTACATAATGAAAAAGG - Intergenic
1040449744 8:47532543-47532565 GGAGTATTACATAATGAAAAAGG + Intronic
1040748475 8:50675398-50675420 AGAGCATTACATAATGATAAAGG - Intronic
1040977676 8:53212557-53212579 AGAGCATTACATATGGTAAAGGG - Intergenic
1041008993 8:53523247-53523269 GGAGCATTATATAAAGAAAAAGG - Intergenic
1041030933 8:53734563-53734585 GGGGCATTATACAAGGAAAAAGG + Intronic
1041049321 8:53917489-53917511 GGAGTTTAATATAAGGAAAATGG - Intronic
1041305518 8:56453952-56453974 GGACCATTACATAATGATAAAGG + Intergenic
1041836043 8:62216502-62216524 GCAGCATTCTAAAATGAAAATGG + Intergenic
1042123375 8:65511983-65512005 GGAGCATTTTAAAAGGATACTGG + Intergenic
1042230781 8:66552298-66552320 GGAGCAGTATTTAGGGATAAAGG - Intergenic
1043152905 8:76740817-76740839 GGAACATTATTTGAGGGAAAAGG + Intronic
1043750180 8:83925414-83925436 AGATCATTATATAATGATAAAGG - Intergenic
1043773620 8:84236506-84236528 GGATCATTATACAATAAAAAAGG - Intronic
1044592795 8:93930304-93930326 GGTCCATTAGATAAGCAAAAAGG + Intergenic
1044619327 8:94173403-94173425 GGAGCATCATATGACGACAATGG - Intronic
1045209206 8:100077953-100077975 GGAACATTACATAATGATAAAGG - Intronic
1045325495 8:101114694-101114716 GGAGCAGTTTCTAAGGGAAAGGG + Intergenic
1045986207 8:108252270-108252292 GGAGTATTATATAAATACAATGG - Intronic
1046339942 8:112840606-112840628 TGATCATTATATAAGGTATAGGG + Intronic
1046414262 8:113890818-113890840 TGAGCATGACATCAGGAAAAAGG - Intergenic
1046491314 8:114955750-114955772 AGAGCATTACATAATGATAAAGG + Intergenic
1047123035 8:121927720-121927742 GAAGCATTTTCTAAGGAAAATGG - Intergenic
1048007892 8:130433788-130433810 AAAGCAATATATAAGGAAAGTGG - Intronic
1048509379 8:135048655-135048677 GAAGCATGAGAAAAGGAAAAGGG - Intergenic
1048676070 8:136781993-136782015 GAAGGAGAATATAAGGAAAAAGG + Intergenic
1048957377 8:139548150-139548172 GGAGCATTATATAAAGAAAAGGG - Intergenic
1050477345 9:6053822-6053844 GAAGCATGATATAAGGTCAAAGG + Intergenic
1050505426 9:6342966-6342988 GGGTCATTATATAATGATAATGG + Intergenic
1050903731 9:10977237-10977259 GGGACATTATATAATGAAAAAGG + Intergenic
1050959038 9:11703795-11703817 TGAGTATTTTATAATGAAAAAGG - Intergenic
1051546653 9:18283175-18283197 GGAGTATTTTATAATGATAAAGG - Intergenic
1051768705 9:20552094-20552116 AGAGCTTTATAAAAGGAAAGTGG - Intronic
1051885904 9:21892523-21892545 AGGGCATTATATAATGATAAAGG + Intronic
1052222410 9:26043246-26043268 GCAGCATTTTATCAGGAAGAAGG - Intergenic
1052266701 9:26582343-26582365 GGAGCATTCTAAAGGCAAAATGG + Intergenic
1052435684 9:28425541-28425563 AGACCATGATAAAAGGAAAAAGG - Intronic
1052767174 9:32652805-32652827 AGGGCATTATATAATGATAAAGG + Intergenic
1052783578 9:32806383-32806405 GGGGCATTACATAATGATAAAGG + Intergenic
1053798754 9:41749855-41749877 AGAGCACCATATAAGGAAAGTGG + Intergenic
1054146454 9:61565103-61565125 AGAGCACCATATAAGGAAAGTGG - Intergenic
1054187168 9:61961898-61961920 AGAGCACCATATAAGGAAAGTGG + Intergenic
1054466185 9:65496182-65496204 AGAGCACCATATAAGGAAAGTGG - Intergenic
1054651343 9:67626623-67626645 AGAGCACCATATAAGGAAAGTGG - Intergenic
1054821331 9:69523403-69523425 AGAGCATTACATAATGATAAAGG + Intronic
1054964519 9:71007117-71007139 GGGCCATTATATAATGACAAAGG + Intronic
1055193820 9:73561963-73561985 GAAACATTATATAATGATAAAGG - Intergenic
1055548295 9:77406048-77406070 AGAGCATTATACAAATAAAAAGG - Intronic
1055624245 9:78157824-78157846 GGAACATTTTATAATGATAAAGG - Intergenic
1055693336 9:78857376-78857398 GCAGCATTGTATGTGGAAAAGGG - Intergenic
1055943092 9:81668798-81668820 GAAGCATTAAATAAGGAGAGAGG + Intronic
1056370355 9:85948002-85948024 GGAGCTTTAGTTAATGAAAAAGG + Intronic
1056865845 9:90226823-90226845 GGAGCGTGATAGAAAGAAAAGGG + Intergenic
1056917173 9:90756080-90756102 GGAGCATGATAGAAAGAAAAGGG - Intergenic
1057239425 9:93395382-93395404 TGAGTAATTTATAAGGAAAAAGG + Intergenic
1059381025 9:113925233-113925255 GGGGCATTACATAATGATAAAGG - Intronic
1059510599 9:114841650-114841672 AGGGCATTATATAATGACAAAGG + Intergenic
1059900351 9:118918518-118918540 AGATCATTATATAATGATAAAGG - Intergenic
1060314255 9:122494417-122494439 GGGACATTATATAATGATAAAGG - Intergenic
1062224086 9:135439232-135439254 GGTGCATTATATAAAGAAAAGGG - Intergenic
1185909963 X:3972178-3972200 GGAGCATTATATAAGTAAAAGGG + Intergenic
1186228407 X:7426237-7426259 TGAGCATTTTATAGGCAAAAGGG + Intergenic
1186442682 X:9599651-9599673 AGAGCCTTGTATAAGGAAATGGG - Intronic
1186571835 X:10723295-10723317 GGAGCTCTACAAAAGGAAAATGG - Intronic
1186622904 X:11260326-11260348 GGAGCATTAGAAAAGGAAGTTGG + Intronic
1187267610 X:17749750-17749772 GAAGAATTATATAATCAAAAGGG + Intronic
1187335853 X:18380953-18380975 GGAGCATTACATAATGAAAAAGG - Intergenic
1187550414 X:20297354-20297376 GGAGAATTATAGAAGAAATAGGG + Intergenic
1187641085 X:21290888-21290910 GGGGCATTACATAATGATAAAGG - Intergenic
1187643821 X:21324371-21324393 GGGGCATTACATAATGACAAAGG - Intergenic
1188317137 X:28688710-28688732 GCAGCATGATATAAGGGAAATGG - Intronic
1188456955 X:30378167-30378189 GGGGCATTATATATGGATAAAGG - Intergenic
1189843813 X:45112693-45112715 GTACCATTTTATATGGAAAAGGG + Intergenic
1189885158 X:45535638-45535660 AGACCATTATATAATGATAAAGG + Intergenic
1189927054 X:45966930-45966952 AGAATATTATATAATGAAAAAGG - Intergenic
1190038128 X:47045311-47045333 AGATCATTATATAATGATAAAGG + Intronic
1190425843 X:50333955-50333977 GGAACATTATATAAGGAGAAGGG - Intronic
1190627827 X:52353708-52353730 GGAGCGTTTTTTCAGGAAAAAGG - Intergenic
1191036036 X:56027447-56027469 GGGGCATTATATAAAGAAAAAGG - Intergenic
1191819736 X:65291928-65291950 GGAGCATTAAATAATGATGAAGG + Intergenic
1191824416 X:65348773-65348795 AGAGCATTATATAATGGTAAAGG + Intergenic
1191957011 X:66653227-66653249 AAAGCATTATATAATGATAAAGG + Intergenic
1192006156 X:67215247-67215269 AGAACATTATATAATGATAAAGG + Intergenic
1192055890 X:67772477-67772499 AGAGCATTATATAATGGTAAAGG + Intergenic
1192395629 X:70778153-70778175 AGGGCATTATATAATGATAAAGG + Intronic
1193070214 X:77298587-77298609 GGAGCACTCTACAAAGAAAATGG + Intergenic
1193073771 X:77333834-77333856 GGAACATTACATAATGATAAAGG + Intergenic
1193409561 X:81145905-81145927 GGAGCATTATATAGTGGTAAAGG + Intronic
1193817711 X:86124127-86124149 AGAGCATTACATAATGATAAAGG - Intergenic
1193916659 X:87372862-87372884 AGGGCATTACATAATGAAAAAGG + Intergenic
1193963517 X:87954362-87954384 AGGGCATTATATAATGATAAAGG + Intergenic
1194072758 X:89348242-89348264 GGGGCATTACATAATGATAAAGG - Intergenic
1194091053 X:89582192-89582214 GGAGCTATATATAAGGAGAGAGG - Intergenic
1194235272 X:91375243-91375265 AGAGCATTACATAATGATAAAGG + Intergenic
1194400551 X:93434451-93434473 GGAGCATTATATAAAGAAAAGGG + Intergenic
1194559177 X:95399279-95399301 GGGTCATTATATAATGATAAAGG + Intergenic
1194774609 X:97946646-97946668 GGAACATTACATAATGATAAAGG + Intergenic
1194791312 X:98154113-98154135 TGGGCATTATATAATAAAAAAGG - Intergenic
1194854467 X:98912683-98912705 AGAGCATTACATAATGATAAAGG - Intergenic
1195018223 X:100799349-100799371 GAAGCATTTTAAAAGGAATATGG - Intergenic
1195306944 X:103593083-103593105 GGGGCATTACATAATGATAAAGG - Intergenic
1195490188 X:105459477-105459499 GGATGAAAATATAAGGAAAAAGG - Intronic
1195506310 X:105661187-105661209 AGATCATTATATAATGATAAAGG + Intronic
1195858728 X:109358275-109358297 GCAACATTAGATCAGGAAAATGG - Intergenic
1196217309 X:113068868-113068890 AGAGAATTATATAATGATAAGGG - Intergenic
1196385299 X:115142070-115142092 AGGTCATTATATAATGAAAAAGG + Intronic
1196571518 X:117270745-117270767 AGAGCATTATATAATGGTAAAGG + Intergenic
1196595448 X:117540786-117540808 GGATCTTTAAATGAGGAAAAGGG - Intergenic
1196696500 X:118618812-118618834 GGAGCATTATATAAGCATTGAGG + Intronic
1197142007 X:123127919-123127941 AGGGCATTACATAATGAAAAAGG + Intergenic
1197303335 X:124808236-124808258 AGATCATTATATAAAGATAAAGG + Intronic
1197393846 X:125901522-125901544 AGGGCATTACATAATGAAAAAGG - Intergenic
1197643294 X:128990593-128990615 GGGTCATTATATAACGATAAAGG - Intergenic
1198469640 X:136934390-136934412 GGATAATTAAATAAAGAAAAGGG - Intergenic
1198736529 X:139791925-139791947 GGAGCTTTATGTCAGGAAACAGG - Intronic
1198801773 X:140455259-140455281 GGAGTATTATATGAGAAATAAGG + Intergenic
1198832763 X:140768310-140768332 GAAGCATTATCAAAGGAGAAAGG - Intergenic
1198888653 X:141367743-141367765 AGAGCATTATATAATGGTAAAGG + Intergenic
1199325256 X:146491486-146491508 AGATCATTATATAATGATAAAGG + Intergenic
1199569067 X:149249106-149249128 GGAACATTTTATAATGATAAAGG - Intergenic
1199693206 X:150324829-150324851 GGAGCATGACACAGGGAAAAAGG - Intergenic
1199706881 X:150435146-150435168 AGAGCATTATATAATGGTAAAGG - Intronic
1199804355 X:151283018-151283040 GCAGGATTATATATAGAAAATGG + Intergenic
1200394078 X:155972923-155972945 GGAGCATTATATAAGTAAAAGGG - Intergenic
1200443696 Y:3238254-3238276 GGAGCTATATATAAGGAGAGAGG - Intergenic
1200573416 Y:4861215-4861237 GGAGCATTACATAATGGTAAAGG - Intergenic
1200726997 Y:6683982-6684004 GGGGCATTACATAATGATAAAGG - Intergenic
1200728149 Y:6699757-6699779 GGGGCATTACATAATGATAAAGG - Intergenic
1200948287 Y:8867408-8867430 GGAGCATTATATAAAGAAAAGGG + Intergenic
1200983607 Y:9284463-9284485 GGAGCATTATATAAAGAAAAAGG - Intergenic
1201378129 Y:13343867-13343889 GGAGCCATATGTAAGGAAAGAGG + Intronic
1201555103 Y:15259025-15259047 GAAGCATTATATAAGGAAAAGGG + Intergenic
1201696928 Y:16836244-16836266 GGAGCATTGTATAGAGAAAAAGG + Intergenic
1201858509 Y:18570892-18570914 GGGGCTATATATAAAGAAAAAGG - Intronic
1201874812 Y:18749489-18749511 GGGGCTATATATAAAGAAAAAGG + Intronic
1201896629 Y:18999009-18999031 GGAGCCATATATAAGGAAAGAGG + Intergenic
1202037301 Y:20647972-20647994 GGGGCATTATACAAGGAAAAAGG + Intergenic
1202126762 Y:21575225-21575247 GGAGCATTATATAAAGAAAAGGG + Intergenic
1202168556 Y:22017375-22017397 GGGGCTATATATAAAGAAAAAGG + Intergenic
1202222805 Y:22568993-22569015 GGGGCTATATATAAAGAAAAAGG - Intergenic
1202320310 Y:23626667-23626689 GGGGCTATATATAAAGAAAAAGG + Intergenic
1202550457 Y:26043389-26043411 GGGGCTATATATAAAGAAAAAGG - Intergenic
1202588762 Y:26460067-26460089 GGTGGATTGGATAAGGAAAATGG - Intergenic