ID: 1098748640

View in Genome Browser
Species Human (GRCh38)
Location 12:74269062-74269084
Sequence GAAAAGGGCCTGTTAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748635_1098748640 5 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748634_1098748640 6 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748633_1098748640 10 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data
1098748636_1098748640 2 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748640 12:74269062-74269084 GAAAAGGGCCTGTTAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748640 Original CRISPR GAAAAGGGCCTGTTAAACTC TGG Intergenic
No off target data available for this crispr