ID: 1098748641

View in Genome Browser
Species Human (GRCh38)
Location 12:74269063-74269085
Sequence AAAAGGGCCTGTTAAACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 11, 1: 10, 2: 42, 3: 53, 4: 873}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098748636_1098748641 3 Left 1098748636 12:74269037-74269059 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748635_1098748641 6 Left 1098748635 12:74269034-74269056 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748633_1098748641 11 Left 1098748633 12:74269029-74269051 CCAACCCTCCAAGTGCATGGAGC No data
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873
1098748634_1098748641 7 Left 1098748634 12:74269033-74269055 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG 0: 11
1: 10
2: 42
3: 53
4: 873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098748641 Original CRISPR AAAAGGGCCTGTTAAACTCT GGG Intergenic
904225871 1:29018844-29018866 CAGAGGGCCCGTGAAACTCTTGG + Intronic
904889747 1:33770949-33770971 CAAAGGGCCAAGTAAACTCTTGG + Intronic
906246155 1:44275725-44275747 ATCAGGGTCTGTTAAATTCTAGG + Intronic
906898827 1:49810331-49810353 TAAAGGGCCTATTACATTCTAGG + Intronic
907316344 1:53575078-53575100 AAAAGGGGTTATTAAACCCTGGG + Intronic
910430881 1:87158694-87158716 AAAAGGGGTTGCTAAACTGTGGG - Intronic
911973359 1:104463728-104463750 AAAAAGGCCTGTTGAACTCAGGG - Intergenic
912723618 1:112040585-112040607 AAAAGGGCCTGACACACTCATGG - Intergenic
915234795 1:154472814-154472836 CAAAGGGCCTGTGAACTTCTAGG - Intronic
915428327 1:155845526-155845548 AAAAGGGACTGTAAAACTGCTGG - Intronic
916102973 1:161408685-161408707 AAAAGGGCCTGTTAAACTCCAGG - Intergenic
916368042 1:164056079-164056101 AAAGGGGCCTGTTTGACTCCAGG - Intergenic
917485417 1:175450779-175450801 AAAAGGGCCCATAAAAATCTAGG + Intronic
918647191 1:186918348-186918370 AAAAGGGCCTGTTAAACTCTGGG - Intronic
919497837 1:198298369-198298391 AAAAGTGCCTATTATATTCTAGG - Intronic
920016885 1:202918666-202918688 AAAAATGCCTATAAAACTCTTGG + Intronic
921683395 1:218061109-218061131 AGAGGGGCCTGTTCAGCTCTAGG + Intergenic
922425715 1:225490706-225490728 AGAAAGCCCTGTTAAAATCTAGG - Exonic
924717477 1:246590841-246590863 AAAAGGCCATGGTTAACTCTAGG - Intronic
1064397224 10:14991670-14991692 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1064400121 10:15014140-15014162 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1064487860 10:15814826-15814848 AGAAGGGCCTATTTCACTCTTGG + Intronic
1066227528 10:33398343-33398365 AAAAGGACTTGTAAAACTGTTGG - Intergenic
1066390400 10:34973489-34973511 AAAAGGGCCTATTGAACTCTGGG + Intergenic
1067976303 10:51029404-51029426 GACATGGACTGTTAAACTCTGGG - Intronic
1071447006 10:85757838-85757860 AAAAGGGTCTGGTACATTCTTGG + Intronic
1072062561 10:91829502-91829524 AGCAGGGCCTGTAAATCTCTGGG - Intronic
1072169717 10:92848091-92848113 ACAAGGGCCTGATGTACTCTGGG - Intronic
1075192624 10:120324670-120324692 AACAGGGCATTTTAAACACTTGG - Intergenic
1075677862 10:124308691-124308713 AAAAATGCCTCTTCAACTCTGGG - Intergenic
1077589036 11:3477523-3477545 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1078636124 11:13052166-13052188 CAAAGAGCCAGTGAAACTCTTGG + Intergenic
1084227712 11:67727649-67727671 AAAAGGGCCTATTGAACTCCGGG - Intergenic
1084244731 11:67849146-67849168 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1084261119 11:67979336-67979358 AAAAGGGCCTATTAAACTCTGGG - Intergenic
1084315320 11:68342400-68342422 ACCAGGGCCTGTGGAACTCTGGG - Intronic
1084807517 11:71589218-71589240 AAAAGGGCCTATTGAACTCTGGG + Intronic
1084811530 11:71614759-71614781 AAAAGGGCCTATTGGACTCTGGG + Intergenic
1084827953 11:71745410-71745432 AAAAGAGCCTATTGAACTCTGGG + Intergenic
1084844610 11:71889223-71889245 AAAAGGGCCTATTGAATTCTAGG + Intronic
1084847462 11:71911681-71911703 AAAAGGGCCTATTGAACTCTGGG + Intronic
1085649632 11:78256013-78256035 AAAAGGGACTATTAATATCTAGG + Intronic
1089513078 11:119013189-119013211 AAAAGTGCTAGTTAAAGTCTAGG - Intronic
1092415295 12:8286291-8286313 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1092432378 12:8419892-8419914 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1092682321 12:10998334-10998356 AAAAGAGCCTGGTGAAATCTAGG + Intronic
1093289296 12:17301614-17301636 AAAAAGGCCTGTTAAACTCTGGG + Intergenic
1094108425 12:26836534-26836556 ATAAGGGCCTCTGATACTCTCGG - Intergenic
1096509008 12:52116858-52116880 AAAACGGCCTATGGAACTCTGGG - Intergenic
1096536044 12:52275491-52275513 AACAGGGAGAGTTAAACTCTAGG - Intronic
1096862446 12:54539688-54539710 AGGAGGGCCTTTTAAACACTGGG - Intronic
1097294958 12:57952451-57952473 AAAAGAGCATGTTTTACTCTAGG - Intronic
1098278824 12:68841530-68841552 AAAAGGGCCTGATGTAATCTAGG - Exonic
1098748641 12:74269063-74269085 AAAAGGGCCTGTTAAACTCTGGG + Intergenic
1099103192 12:78468569-78468591 AAATGTGTCTGTTCAACTCTAGG - Intergenic
1099176442 12:79428259-79428281 AATAGGGCCCTCTAAACTCTGGG - Intronic
1099936728 12:89134893-89134915 AGAAGGACCTGGGAAACTCTGGG + Intergenic
1101029252 12:100643870-100643892 AAAAAGACCTGTTAAACTCTGGG - Intergenic
1101646326 12:106633942-106633964 AAGAGGACCTGTCAGACTCTGGG - Intronic
1102602422 12:114041874-114041896 AAAAGGTCCTCTTTAACTCCTGG + Intergenic
1102664348 12:114557353-114557375 CAAAAGGCCTGTTAATCTGTAGG + Intergenic
1102818147 12:115885622-115885644 ACAAGGGCCTTTTAAAATGTTGG - Intergenic
1103896113 12:124274408-124274430 AAAGGGGCCCCTTAAACTGTGGG - Intronic
1104292909 12:127485582-127485604 AAAAAGGCCTGTTGAACTCTGGG + Intergenic
1105100521 13:16444952-16444974 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105121253 13:16783835-16783857 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105124023 13:16828860-16828882 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105134354 13:16997511-16997533 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105140664 13:17101204-17101226 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105146789 13:17200470-17200492 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105151378 13:17275529-17275551 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105151463 13:17276890-17276912 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1105911161 13:24869150-24869172 AATAGTGCCTGTTAAATACTAGG + Intronic
1107178936 13:37433775-37433797 ACAAGGGCCTGATCAACTTTTGG + Intergenic
1107490504 13:40876626-40876648 AAAAGGGCCTGTTGAACTCTGGG - Intergenic
1107544159 13:41421458-41421480 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1108875493 13:55044047-55044069 AAGAGTGCCTATTAAAGTCTTGG + Intergenic
1109803001 13:67401927-67401949 AAAAGGGCCTGTTAAACTCTGGG + Intergenic
1113027983 13:105962139-105962161 GAAGGGGCCTGTGCAACTCTTGG + Intergenic
1117038793 14:51751681-51751703 AAAAGGGCCTATCGAACTCTGGG + Intergenic
1118008659 14:61588218-61588240 AAAAGTGCCTTTTAAATACTAGG - Intronic
1124615722 15:31240759-31240781 AAAAGACCCTGTTAAAATCGAGG + Intergenic
1124881322 15:33645534-33645556 AAAAGTGACTCTTAAACTGTTGG + Intronic
1125790565 15:42362380-42362402 TTAAGGGCCTGTTATGCTCTAGG + Intronic
1126028361 15:44471539-44471561 AAAGGGGCAGGGTAAACTCTGGG - Intronic
1126523883 15:49628546-49628568 AAGAGAGCCTTTTAAATTCTAGG - Intronic
1126846326 15:52763973-52763995 GACAGGGCTTCTTAAACTCTAGG - Intronic
1127096305 15:55515091-55515113 AAAAGGGCCGGTTAAACTCTGGG - Intergenic
1127246234 15:57178052-57178074 AAAAGAGCCTGTTAAATAATGGG + Intronic
1129494240 15:75962399-75962421 AGGAGGCCCTGTTAAACACTGGG - Intronic
1137095936 16:36256902-36256924 GAAAGGGAATGTTCAACTCTGGG + Intergenic
1137095982 16:36257582-36257604 GAAAGGGAATGTTCAACTCTCGG + Intergenic
1140848213 16:78909812-78909834 AAAAGGGCCAGTTACTGTCTGGG + Intronic
1141007371 16:80364854-80364876 AAAAGGGCTTGATGAACGCTTGG + Intergenic
1145864848 17:28234498-28234520 AAAAGCGCCTATTGAACTCTGGG - Intergenic
1147798549 17:43064528-43064550 AGAAGGGCCTTTGAAACACTGGG - Intronic
1148833015 17:50447998-50448020 CAAAGTGTCTGTCAAACTCTTGG + Intronic
1149076125 17:52597516-52597538 AAAAAGGCCTGTTGAACTCTGGG + Intergenic
1152463917 17:80455210-80455232 AAAGGGCCCTGTTAAACGCTGGG - Intergenic
1157303018 18:46493776-46493798 GAGATGGCATGTTAAACTCTAGG - Intronic
1160233052 18:77063305-77063327 GGAAGGGCCTGTTGAACTGTGGG - Intronic
1162284206 19:9726112-9726134 AAAAGGGCCTGTTAAACTCTGGG - Intergenic
1163916788 19:20247097-20247119 AAACAGGCCTGTTAAACTCTGGG + Intergenic
1163943210 19:20513826-20513848 AAAAGGGCCTGTTAAACTCTGGG - Intergenic
1163966374 19:20750818-20750840 AAAAGGGCCTATTGAACTCTGGG - Intronic
1164481052 19:28611266-28611288 AAAAAGGCCTATTGAACTCTGGG + Intergenic
929856013 2:45639277-45639299 AAAGGGTCCTGTTAACCTCTAGG - Intergenic
930518550 2:52435519-52435541 AAAAAGGCCTGTTGAACTCTGGG + Intergenic
930535823 2:52644916-52644938 AAAAAGGCCTCTAAGACTCTTGG - Intergenic
930912170 2:56642074-56642096 AGAGAGGCCTGTTAAATTCTTGG + Intergenic
931698382 2:64889217-64889239 GAAAAGTCCTGTTGAACTCTGGG - Intergenic
932349944 2:71023605-71023627 AAAAGGGCCTATTGAACTCTGGG + Intergenic
932353439 2:71049743-71049765 AAAAGGGCCTACTGAACTCTGGG + Intergenic
934332621 2:92085038-92085060 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934332875 2:92088798-92088820 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934332974 2:92090509-92090531 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934333076 2:92092218-92092240 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934333189 2:92093922-92093944 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934334193 2:92108918-92108940 TAAAGGGAATGTTGAACTCTGGG - Intergenic
934338323 2:92223525-92223547 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934351004 2:92424755-92424777 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934384305 2:92956629-92956651 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934411412 2:93393576-93393598 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934412805 2:93415992-93416014 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934421774 2:93560673-93560695 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934428820 2:93673481-93673503 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934456434 2:94169105-94169127 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934456662 2:94172525-94172547 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934456802 2:94174578-94174600 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934456913 2:94176288-94176310 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457019 2:94177998-94178020 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457133 2:94179705-94179727 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457246 2:94181413-94181435 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457357 2:94183119-94183141 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457491 2:94185168-94185190 GAAAGGGAATGTTCAACTCTGGG - Intergenic
934457596 2:94186878-94186900 GAAAGGGAATGTTCAACTCTGGG - Intergenic
935829576 2:106986970-106986992 AAAAGGGACTGACAAGCTCTGGG + Intergenic
935903731 2:107820103-107820125 AAGAGGACTTTTTAAACTCTCGG - Intergenic
936497060 2:113031545-113031567 AAAACGGCCTTTGAAAATCTCGG - Intronic
938681181 2:133691661-133691683 AGAAGGACCTGATAGACTCTGGG + Intergenic
939632269 2:144539104-144539126 AAAAGGGTCAGTGAAACTCTTGG + Intergenic
940516268 2:154687468-154687490 AAATGAGCCTGTCAGACTCTGGG - Intergenic
940869524 2:158848382-158848404 AAAAGGGCCTATTGAACTCTGGG + Intronic
940872200 2:158869380-158869402 AAAAGGGCCTATTGAACTCTGGG + Intergenic
940874407 2:158885368-158885390 AAAAGGGCCTATTGAACTCTGGG + Intergenic
941193256 2:162413699-162413721 AAAAGGCCCTACTAAACTTTTGG - Intronic
943225740 2:185173014-185173036 AAACATGCCTGTTAAACTCAAGG - Intergenic
943239971 2:185370656-185370678 AAAATGGCATTGTAAACTCTGGG + Intergenic
947376365 2:229500413-229500435 AAAAGGGACTCTTGAACACTGGG + Intronic
947595001 2:231405526-231405548 AAAAGGGCCTATTGAACTCTGGG + Intergenic
1169947352 20:11003377-11003399 AGAAGGGCCTGTTACCATCTCGG + Intergenic
1170452689 20:16501366-16501388 AGAAGTGCCGGTTAAATTCTTGG - Intronic
1171408545 20:24930244-24930266 AAAAGGGCCTATTGAACTCTGGG + Intergenic
1171591455 20:26608357-26608379 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171591615 20:26610735-26610757 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171591817 20:26613796-26613818 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171591991 20:26616513-26616535 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171592171 20:26619233-26619255 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171592353 20:26621952-26621974 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171592539 20:26624669-26624691 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171593017 20:26631807-26631829 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171593201 20:26634936-26634958 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171593376 20:26637655-26637677 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171593556 20:26640375-26640397 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171593868 20:26645138-26645160 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171594103 20:26648494-26648516 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171594285 20:26651215-26651237 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171594467 20:26653934-26653956 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171594647 20:26656654-26656676 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171594828 20:26659374-26659396 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171595010 20:26662093-26662115 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171595192 20:26664814-26664836 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171595489 20:26669235-26669257 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171595671 20:26671954-26671976 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171595854 20:26674673-26674695 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596036 20:26677393-26677415 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596218 20:26680116-26680138 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596388 20:26682663-26682685 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596657 20:26686740-26686762 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596752 20:26688100-26688122 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171596934 20:26690820-26690842 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597116 20:26693539-26693561 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597294 20:26696259-26696281 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597456 20:26698640-26698662 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597634 20:26701357-26701379 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597813 20:26704076-26704098 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171597994 20:26706797-26706819 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171598177 20:26709515-26709537 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171598336 20:26711892-26711914 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171598505 20:26714442-26714464 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171598687 20:26717162-26717184 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599050 20:26722601-26722623 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599231 20:26725318-26725340 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599409 20:26728040-26728062 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599589 20:26730761-26730783 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599759 20:26733307-26733329 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171599940 20:26736021-26736043 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171600143 20:26739083-26739105 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171600326 20:26741803-26741825 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171600504 20:26744524-26744546 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171600689 20:26747238-26747260 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171600893 20:26750299-26750321 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171601079 20:26753019-26753041 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171601261 20:26755739-26755761 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171601490 20:26759134-26759156 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171601674 20:26761853-26761875 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171601859 20:26764572-26764594 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602041 20:26767289-26767311 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602222 20:26770009-26770031 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602405 20:26772729-26772751 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602584 20:26775448-26775470 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602782 20:26778509-26778531 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171602962 20:26781228-26781250 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171603231 20:26785306-26785328 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171603411 20:26788023-26788045 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171603594 20:26790743-26790765 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171603775 20:26793462-26793484 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171604048 20:26797542-26797564 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171604231 20:26800261-26800283 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171604503 20:26804339-26804361 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171604685 20:26807058-26807080 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171604865 20:26809776-26809798 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171605046 20:26812495-26812517 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171605245 20:26815556-26815578 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171605427 20:26818278-26818300 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171605698 20:26822356-26822378 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171605878 20:26825077-26825099 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171606023 20:26827118-26827140 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171606314 20:26831537-26831559 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171606608 20:26835957-26835979 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171606787 20:26838678-26838700 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171607058 20:26842758-26842780 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171607258 20:26845818-26845840 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171607440 20:26848536-26848558 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171607622 20:26851255-26851277 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171607822 20:26854317-26854339 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171608005 20:26857037-26857059 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171608188 20:26859757-26859779 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171608391 20:26862818-26862840 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171608574 20:26865537-26865559 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171608863 20:26869956-26869978 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171609023 20:26872333-26872355 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171609208 20:26875053-26875075 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171609388 20:26877772-26877794 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171609680 20:26882193-26882215 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171609864 20:26884911-26884933 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610047 20:26887631-26887653 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610253 20:26890690-26890712 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610436 20:26893410-26893432 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610616 20:26896128-26896150 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610773 20:26898507-26898529 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171610844 20:26899525-26899547 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611027 20:26902244-26902266 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611210 20:26904964-26904986 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611390 20:26907686-26907708 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611572 20:26910406-26910428 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611753 20:26913125-26913147 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171611935 20:26915842-26915864 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171612112 20:26918561-26918583 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171612293 20:26921280-26921302 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171612585 20:26925701-26925723 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171612767 20:26928423-26928445 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171612945 20:26931143-26931165 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171613128 20:26933863-26933885 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171613312 20:26936582-26936604 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171613495 20:26939302-26939324 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171613676 20:26942021-26942043 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171613859 20:26944740-26944762 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171614040 20:26947460-26947482 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171614221 20:26950181-26950203 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171614404 20:26952900-26952922 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171614599 20:26955961-26955983 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171614894 20:26960379-26960401 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615076 20:26963099-26963121 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615201 20:26964966-26964988 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615323 20:26966665-26966687 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615522 20:26969726-26969748 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615704 20:26972446-26972468 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171615888 20:26975166-26975188 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616071 20:26977883-26977905 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616231 20:26980260-26980282 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616399 20:26982811-26982833 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616584 20:26985529-26985551 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616767 20:26988248-26988270 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171616944 20:26990971-26990993 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171617127 20:26993692-26993714 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171617310 20:26996411-26996433 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171617517 20:26999472-26999494 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171617719 20:27002534-27002556 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171617887 20:27005082-27005104 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171618045 20:27007460-27007482 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171618337 20:27011882-27011904 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171618624 20:27016303-27016325 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171618810 20:27019022-27019044 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171619013 20:27022085-27022107 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171619287 20:27026163-27026185 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171619471 20:27028881-27028903 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171619763 20:27033300-27033322 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171619834 20:27034319-27034341 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171620231 20:27040445-27040467 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171620527 20:27044866-27044888 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171620707 20:27047585-27047607 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171620876 20:27050133-27050155 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171620968 20:27051488-27051510 TAAAGGGAATGTTGAACTCTGGG - Intergenic
1171621019 20:27052169-27052191 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171621199 20:27054889-27054911 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171621382 20:27057608-27057630 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171621567 20:27060327-27060349 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171621752 20:27063044-27063066 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622075 20:27068147-27068169 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622256 20:27070867-27070889 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622437 20:27073587-27073609 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622623 20:27076311-27076333 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622782 20:27078690-27078712 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171622965 20:27081409-27081431 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171623263 20:27085826-27085848 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171623434 20:27088374-27088396 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171623636 20:27091436-27091458 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171623925 20:27095858-27095880 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171624261 20:27100963-27100985 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171624444 20:27103682-27103704 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171624626 20:27106401-27106423 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171624804 20:27109120-27109142 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171624989 20:27111839-27111861 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171625280 20:27116257-27116279 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171625457 20:27118975-27118997 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171625631 20:27121523-27121545 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171625814 20:27124244-27124266 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171626000 20:27126963-27126985 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171626404 20:27133083-27133105 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171626564 20:27135460-27135482 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171626701 20:27137500-27137522 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171626881 20:27140219-27140241 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171627176 20:27144640-27144662 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171627354 20:27147359-27147381 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171627537 20:27150079-27150101 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171627697 20:27152456-27152478 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171627877 20:27155175-27155197 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171628059 20:27157894-27157916 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171628244 20:27160613-27160635 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171628360 20:27162310-27162332 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171628546 20:27165029-27165051 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171628815 20:27169105-27169127 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171629000 20:27171826-27171848 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171629290 20:27176247-27176269 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171629472 20:27178966-27178988 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171629656 20:27181685-27181707 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171629838 20:27184404-27184426 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171630006 20:27186954-27186976 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171630296 20:27191375-27191397 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171630479 20:27194095-27194117 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171630662 20:27196813-27196835 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171630844 20:27199533-27199555 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171631028 20:27202253-27202275 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171631209 20:27204972-27204994 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171631392 20:27207691-27207713 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171631571 20:27210410-27210432 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171631863 20:27214828-27214850 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171632262 20:27220950-27220972 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171632623 20:27226389-27226411 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171632805 20:27229109-27229131 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171632990 20:27231831-27231853 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171633172 20:27234552-27234574 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171633355 20:27237271-27237293 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171633540 20:27239990-27240012 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171633722 20:27242709-27242731 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171633914 20:27245598-27245620 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171634097 20:27248319-27248341 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171634280 20:27251038-27251060 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171634464 20:27253765-27253787 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171634693 20:27257164-27257186 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171634878 20:27259883-27259905 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635062 20:27262600-27262622 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635244 20:27265319-27265341 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635408 20:27267697-27267719 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635588 20:27270416-27270438 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635749 20:27272795-27272817 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171635929 20:27275514-27275536 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171636111 20:27278234-27278256 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171636351 20:27281802-27281824 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171636533 20:27284522-27284544 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171636715 20:27287246-27287268 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171636918 20:27290308-27290330 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637098 20:27293028-27293050 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637302 20:27296215-27296237 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637480 20:27298932-27298954 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637549 20:27299950-27299972 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637730 20:27302670-27302692 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171637911 20:27305389-27305411 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171638092 20:27308108-27308130 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171638275 20:27310828-27310850 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171638479 20:27313889-27313911 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171638660 20:27316608-27316630 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171639060 20:27322730-27322752 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171639244 20:27325449-27325471 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171639427 20:27328170-27328192 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171639703 20:27332244-27332266 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171639779 20:27333263-27333285 AAAAGGGAATGTTGAACACTGGG - Intergenic
1171639964 20:27335984-27336006 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171640139 20:27338534-27338556 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171640315 20:27341253-27341275 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171640497 20:27343972-27343994 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171640676 20:27346691-27346713 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171640971 20:27351114-27351136 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171641251 20:27355361-27355383 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171641456 20:27358424-27358446 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171641748 20:27362843-27362865 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171641932 20:27365562-27365584 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171642114 20:27368281-27368303 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171642299 20:27371001-27371023 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171642483 20:27373718-27373740 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171642663 20:27376437-27376459 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171642846 20:27379157-27379179 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643028 20:27381875-27381897 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643210 20:27384592-27384614 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643390 20:27387311-27387333 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643574 20:27390031-27390053 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643757 20:27392751-27392773 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171643938 20:27395471-27395493 AAAAGGGTATGTTCAACACTGGG - Intergenic
1171644122 20:27398192-27398214 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171644434 20:27402956-27402978 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171644641 20:27406017-27406039 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171644843 20:27409079-27409101 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171644917 20:27410097-27410119 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645096 20:27412816-27412838 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645295 20:27415877-27415899 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645476 20:27418595-27418617 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645661 20:27421316-27421338 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645842 20:27424034-27424056 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171645915 20:27425052-27425074 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646097 20:27427769-27427791 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646185 20:27429126-27429148 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646257 20:27430144-27430166 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646440 20:27432864-27432886 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646627 20:27435580-27435602 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646799 20:27438127-27438149 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171646981 20:27440847-27440869 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647152 20:27443395-27443417 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647332 20:27446115-27446137 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647532 20:27449175-27449197 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647716 20:27451894-27451916 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647811 20:27453255-27453277 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171647999 20:27455976-27455998 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171648291 20:27460396-27460418 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171648473 20:27463115-27463137 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171648656 20:27465834-27465856 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171648950 20:27470252-27470274 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171649152 20:27473312-27473334 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171649334 20:27476032-27476054 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171649539 20:27479092-27479114 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171649720 20:27481811-27481833 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171649903 20:27484530-27484552 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650087 20:27487248-27487270 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650269 20:27489967-27489989 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650450 20:27492686-27492708 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650629 20:27495404-27495426 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650811 20:27498123-27498145 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171650995 20:27500841-27500863 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651177 20:27503560-27503582 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651257 20:27504834-27504856 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651454 20:27507896-27507918 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651633 20:27510615-27510637 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651794 20:27512992-27513014 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171651977 20:27515711-27515733 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171652161 20:27518430-27518452 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171652685 20:27526670-27526692 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171652864 20:27529388-27529410 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171653044 20:27532107-27532129 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171653244 20:27535169-27535191 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171653423 20:27537889-27537911 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171653705 20:27542138-27542160 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171653988 20:27546387-27546409 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171654169 20:27549108-27549130 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171654352 20:27551828-27551850 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171654535 20:27554545-27554567 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171654715 20:27557267-27557289 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171654897 20:27559986-27560008 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171655086 20:27562703-27562725 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171655380 20:27567125-27567147 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171655561 20:27569845-27569867 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171655676 20:27571543-27571565 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171655859 20:27574262-27574284 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656038 20:27576982-27577004 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656205 20:27579528-27579550 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656374 20:27582076-27582098 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656575 20:27585133-27585155 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656776 20:27588195-27588217 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171656846 20:27589213-27589235 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657027 20:27591931-27591953 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657209 20:27594651-27594673 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657391 20:27597372-27597394 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657573 20:27600091-27600113 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657800 20:27603490-27603512 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171657970 20:27606036-27606058 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171658280 20:27610798-27610820 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171658481 20:27613862-27613884 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171658660 20:27616581-27616603 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171658946 20:27621000-27621022 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171659108 20:27623377-27623399 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171659291 20:27626095-27626117 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171659637 20:27631192-27631214 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171659809 20:27633740-27633762 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660002 20:27636626-27636648 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660187 20:27639345-27639367 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660369 20:27642065-27642087 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660572 20:27645126-27645148 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660750 20:27647848-27647870 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171660822 20:27648866-27648888 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661004 20:27651586-27651608 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661185 20:27654307-27654329 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661324 20:27656348-27656370 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661509 20:27659067-27659089 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661669 20:27661445-27661467 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661853 20:27664164-27664186 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171661924 20:27665181-27665203 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171662306 20:27670960-27670982 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171662491 20:27673678-27673700 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171662674 20:27676397-27676419 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171662855 20:27679118-27679140 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171663147 20:27683539-27683561 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171663330 20:27686259-27686281 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171663480 20:27688467-27688489 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171663652 20:27691016-27691038 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171663835 20:27693736-27693758 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171664005 20:27696284-27696306 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171664187 20:27699002-27699024 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171664365 20:27701722-27701744 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171664651 20:27706144-27706166 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171664852 20:27709206-27709228 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665014 20:27711584-27711606 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665195 20:27714302-27714324 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665362 20:27716850-27716872 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665542 20:27719569-27719591 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665830 20:27723988-27724010 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171665990 20:27726365-27726387 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666184 20:27729255-27729277 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666370 20:27731975-27731997 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666551 20:27734695-27734717 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666734 20:27737415-27737437 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666803 20:27738433-27738455 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171666985 20:27741152-27741174 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171667163 20:27743871-27743893 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171667342 20:27746589-27746611 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171667523 20:27749309-27749331 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171667706 20:27752028-27752050 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171667975 20:27756105-27756127 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668145 20:27758654-27758676 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668329 20:27761371-27761393 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668424 20:27762731-27762753 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668595 20:27765281-27765303 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668776 20:27767999-27768021 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171668941 20:27770545-27770567 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171669231 20:27774964-27774986 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171669411 20:27777684-27777706 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171669595 20:27780405-27780427 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171669888 20:27784828-27784850 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670088 20:27787889-27787911 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670274 20:27790609-27790631 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670453 20:27793328-27793350 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670637 20:27796047-27796069 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670708 20:27797065-27797087 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171670882 20:27799613-27799635 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671085 20:27802670-27802692 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671267 20:27805389-27805411 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671437 20:27807936-27807958 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671505 20:27808954-27808976 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671691 20:27811673-27811695 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171671871 20:27814390-27814412 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171672320 20:27821195-27821217 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171672489 20:27823743-27823765 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171672673 20:27826463-27826485 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171672842 20:27829011-27829033 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171673026 20:27831730-27831752 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171673321 20:27836151-27836173 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171673503 20:27838870-27838892 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171673686 20:27841592-27841614 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171673979 20:27846012-27846034 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171674161 20:27848730-27848752 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171674444 20:27852981-27853003 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171674624 20:27855701-27855723 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171674805 20:27858421-27858443 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171675322 20:27866244-27866266 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171675505 20:27868966-27868988 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171675687 20:27871753-27871775 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171675942 20:27875491-27875513 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171676115 20:27878039-27878061 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171676298 20:27880758-27880780 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171676454 20:27883135-27883157 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171676657 20:27886196-27886218 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171676825 20:27888742-27888764 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171677005 20:27891460-27891482 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171677184 20:27894177-27894199 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171677466 20:27898425-27898447 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171677645 20:27901144-27901166 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171677828 20:27903863-27903885 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171678098 20:27907942-27907964 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171678269 20:27910491-27910513 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171678450 20:27913211-27913233 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171678615 20:27915590-27915612 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171678953 20:27920696-27920718 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171679135 20:27923415-27923437 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171679314 20:27926134-27926156 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171679610 20:27930555-27930577 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171679888 20:27934803-27934825 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680070 20:27937522-27937544 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680240 20:27940072-27940094 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680509 20:27944150-27944172 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680692 20:27946871-27946893 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680763 20:27947889-27947911 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171680952 20:27950781-27950803 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681024 20:27951799-27951821 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681166 20:27953836-27953858 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681460 20:27958257-27958279 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681641 20:27960974-27960996 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681855 20:27964200-27964222 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171681925 20:27965219-27965241 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682109 20:27967938-27967960 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682292 20:27970656-27970678 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682474 20:27973377-27973399 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682656 20:27976094-27976116 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682726 20:27977112-27977134 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171682886 20:27979488-27979510 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683086 20:27982547-27982569 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683262 20:27985270-27985292 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683442 20:27987991-27988013 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683627 20:27990710-27990732 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683812 20:27993433-27993455 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171683953 20:27995473-27995495 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171684134 20:27998192-27998214 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171684316 20:28000912-28000934 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171684715 20:28007031-28007053 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171684962 20:28010767-28010789 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171685131 20:28013315-28013337 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171685420 20:28017734-28017756 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171685602 20:28020452-28020474 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171685784 20:28023172-28023194 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171685854 20:28024190-28024212 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686023 20:28026738-28026760 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686094 20:28027756-28027778 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686207 20:28029457-28029479 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686282 20:28030476-28030498 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686577 20:28034896-28034918 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686763 20:28037615-28037637 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171686944 20:28040334-28040356 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171687113 20:28042883-28042905 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171687435 20:28047809-28047831 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171687605 20:28050356-28050378 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171688324 20:28061238-28061260 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171688497 20:28063786-28063808 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171688679 20:28066503-28066525 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171688774 20:28067863-28067885 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171688957 20:28070581-28070603 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171689028 20:28071599-28071621 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171689205 20:28074319-28074341 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171689276 20:28075337-28075359 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171689560 20:28079588-28079610 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171689868 20:28084350-28084372 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690051 20:28087069-28087091 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690222 20:28089620-28089642 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690293 20:28090638-28090660 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690475 20:28093358-28093380 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690647 20:28095906-28095928 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171690851 20:28098970-28098992 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691040 20:28101864-28101886 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691111 20:28102882-28102904 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691396 20:28107131-28107153 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691566 20:28109679-28109701 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691749 20:28112399-28112421 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171691929 20:28115119-28115141 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171692273 20:28120218-28120240 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171692443 20:28122767-28122789 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171692627 20:28125484-28125506 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171692797 20:28128033-28128055 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171692973 20:28130586-28130608 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693155 20:28133305-28133327 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693337 20:28136024-28136046 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693409 20:28137043-28137065 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693589 20:28139762-28139784 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693884 20:28144184-28144206 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171693958 20:28145204-28145226 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171694130 20:28147751-28147773 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171694302 20:28150300-28150322 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171694488 20:28153020-28153042 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171694915 20:28159487-28159509 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171695099 20:28162205-28162227 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171695281 20:28164923-28164945 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171695452 20:28167472-28167494 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171695818 20:28173085-28173107 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171695989 20:28175635-28175657 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171696363 20:28181015-28181037 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171696645 20:28185262-28185284 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171696991 20:28190358-28190380 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697163 20:28192910-28192932 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697357 20:28195801-28195823 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697513 20:28198179-28198201 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697583 20:28199196-28199218 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697753 20:28201745-28201767 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171697923 20:28204293-28204315 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698091 20:28206842-28206864 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698257 20:28209391-28209413 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698447 20:28212283-28212305 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698621 20:28214831-28214853 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698788 20:28217379-28217401 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171698969 20:28220100-28220122 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171699250 20:28224350-28224372 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171699544 20:28228940-28228962 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171699882 20:28234036-28234058 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171700119 20:28237605-28237627 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171700286 20:28240158-28240180 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171700718 20:28246793-28246815 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171701108 20:28252742-28252764 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171701189 20:28253930-28253952 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171701363 20:28256735-28256757 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171701532 20:28259284-28259306 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171702334 20:28271527-28271549 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171702627 20:28275948-28275970 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703019 20:28281900-28281922 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703321 20:28286492-28286514 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703489 20:28289041-28289063 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703571 20:28290229-28290251 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703738 20:28292776-28292798 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171703909 20:28295323-28295345 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171704079 20:28297872-28297894 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171704370 20:28302289-28302311 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171704870 20:28309944-28309966 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171705170 20:28314535-28314557 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171705336 20:28317082-28317104 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171705645 20:28321625-28321647 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171705819 20:28324173-28324195 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171706095 20:28328424-28328446 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171706266 20:28330973-28330995 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171706436 20:28333520-28333542 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171706690 20:28337425-28337447 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171706858 20:28339973-28339995 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171707029 20:28342520-28342542 AAAAGGGAATGTTGAACACTGGG - Intergenic
1171707200 20:28345068-28345090 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171707371 20:28347619-28347641 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171707764 20:28353568-28353590 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171708050 20:28357818-28357840 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171708327 20:28362066-28362088 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171708499 20:28364617-28364639 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171708668 20:28367162-28367184 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171708951 20:28371412-28371434 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709119 20:28373960-28373982 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709288 20:28376508-28376530 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709456 20:28379057-28379079 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709625 20:28381606-28381628 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709800 20:28384154-28384176 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171709947 20:28386360-28386382 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171710117 20:28388910-28388932 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171710286 20:28391458-28391480 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171710453 20:28394007-28394029 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171710623 20:28396555-28396577 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171710802 20:28399275-28399297 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171711082 20:28403525-28403547 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171711257 20:28406074-28406096 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171711326 20:28407092-28407114 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171711495 20:28409638-28409660 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171711664 20:28412186-28412208 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712130 20:28419334-28419356 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712202 20:28420352-28420374 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712371 20:28422902-28422924 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712543 20:28425454-28425476 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712717 20:28428003-28428025 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171712889 20:28430551-28430573 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713057 20:28433100-28433122 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713226 20:28435648-28435670 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713395 20:28438195-28438217 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713565 20:28440743-28440765 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713734 20:28443289-28443311 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171713905 20:28445837-28445859 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714095 20:28448708-28448730 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714269 20:28451256-28451278 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714440 20:28453802-28453824 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714608 20:28456353-28456375 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714778 20:28458902-28458924 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171714949 20:28461451-28461473 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715124 20:28463998-28464020 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715290 20:28466546-28466568 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715458 20:28469094-28469116 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715627 20:28471642-28471664 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715795 20:28474191-28474213 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171715964 20:28476740-28476762 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716133 20:28479288-28479310 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716303 20:28481836-28481858 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716473 20:28484384-28484406 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716642 20:28486936-28486958 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716813 20:28489485-28489507 AAAAGGGAATGTTCAACACTGGG - Intergenic
1171716983 20:28492032-28492054 AAAAGGGAATGTTCAACACTGGG - Intergenic
1174491855 20:50904578-50904600 AAAATGTCCTGTTAAAAACTGGG - Intronic
1174558983 20:51416504-51416526 TAAAGGGCCCGTTCAAATCTGGG + Intronic
1174663099 20:52232705-52232727 TAAAGGGCTTTTTCAACTCTTGG - Intergenic
1178298501 21:31431047-31431069 CAAAGGGCCTGGTCACCTCTGGG - Intronic
1178447714 21:32660791-32660813 AAAAGGGCCTGTTAAACTCTAGG + Intronic
1181656993 22:24309998-24310020 TAAATTGCCTGTTAACCTCTGGG - Intronic
1202716029 2_KI270715v1_random:3273-3295 TAAAGGGAATGTTGAACTCTGGG - Intergenic
1202716736 2_KI270715v1_random:13493-13515 TAAAGGGAATGTTGAACTCTGGG - Intergenic
1202717486 2_KI270715v1_random:24723-24745 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202721120 2_KI270715v1_random:81797-81819 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202727040 2_KI270716v1_random:11646-11668 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202727295 2_KI270716v1_random:15406-15428 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202727395 2_KI270716v1_random:17117-17139 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202727497 2_KI270716v1_random:18826-18848 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202727610 2_KI270716v1_random:20530-20552 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202728722 2_KI270716v1_random:37232-37254 TAAAGGGAATGTTGAACTCTGGG - Intergenic
1202729051 2_KI270716v1_random:42001-42023 TAAAGGGAATGTTGAACTCTGGG - Intergenic
1202731177 2_KI270716v1_random:74987-75009 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202731395 2_KI270716v1_random:78387-78409 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202732651 2_KI270716v1_random:98103-98125 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1202732676 2_KI270716v1_random:98445-98467 GAAAGGGAATGTTCAACTCTGGG - Intergenic
949158116 3:851153-851175 AAAAAGGCCTGTTGAACTCTGGG + Intergenic
949884562 3:8682966-8682988 AAAAAGGCCTATTTAACTCTGGG + Intronic
951049914 3:18082743-18082765 ATAAGGGCCTATTAAAGTCTTGG + Intronic
951166011 3:19485886-19485908 AAAAGGGCCTGTTAAACCCTGGG - Intronic
953616617 3:44496486-44496508 AAAAGGCCCTGAAAAACTTTAGG + Intergenic
957022499 3:75140955-75140977 AAAAAGGCCTATTGAACTCTGGG + Intergenic
957044391 3:75362714-75362736 AAAAGGTCCTATTGAACTCTGGG - Intergenic
957076186 3:75604897-75604919 AAAAGGGCCTATTGAACTCTGGG - Intergenic
957167031 3:76687914-76687936 AAAAGGGCATATTTAACTATGGG + Intronic
960395962 3:117137975-117137997 AAAGAGGCCTGTTTAACTTTGGG - Intronic
961272250 3:125698048-125698070 AAAAGGGCCTACTGAACTCTGGG + Intergenic
961275113 3:125720285-125720307 AAAAGGGCCTACTGAACTCTGGG + Intergenic
961278030 3:125742908-125742930 AAAAGGGCCTACTGAACTCTGGG + Intergenic
961876384 3:130026748-130026770 AAAAGGGCCTACTGAACTCTGGG - Intergenic
961892845 3:130144905-130144927 AAAAGGGCCTAATGAACTCTGGG - Intergenic
962617086 3:137137416-137137438 GAAAGGGCCTGCTAAATGCTTGG - Intergenic
964522397 3:157583193-157583215 AAAAGGGCCTGTTAAACTCTGGG - Intronic
968556499 4:1248631-1248653 AAAAGGGCCTGTGGGCCTCTGGG - Intronic
968988655 4:3893954-3893976 AAAAGGGCCTATTGAACTCTGGG - Intergenic
969019636 4:4131197-4131219 AAAAGGGCCTATTGAACTCTGGG - Intergenic
969024342 4:4161597-4161619 AAAAAGGCCTATTGAACTCTTGG - Intergenic
969646979 4:8436473-8436495 AAAAGGGCCTGTTAAGATCTAGG + Intronic
969729475 4:8945568-8945590 AAAAGCGCCTATTGAACTCTGGG + Intergenic
969734215 4:8976211-8976233 AAAAGGGCCTCTTGAACTCTGGG + Intergenic
969749918 4:9102236-9102258 AAAAGGGCCTACTGAACCCTGGG + Intergenic
969785643 4:9455097-9455119 AAAAGGACCTATTGAACTCTGGG + Intergenic
969789065 4:9479507-9479529 AAAAGGGCCTATTGAACTCTGGG + Intergenic
969793802 4:9510275-9510297 AAAAGGGCCTATTGAACTCTGGG + Intergenic
970902491 4:21175933-21175955 AAATGGGAGTTTTAAACTCTGGG - Intronic
970909746 4:21261059-21261081 AAAACCGGCTGTTAAATTCTAGG - Intronic
972077470 4:35105250-35105272 AAAAAGCCCTGTTAAATTCTGGG + Intergenic
972746543 4:41938005-41938027 ACAAGGGCCTGGCATACTCTAGG - Intronic
972909085 4:43791542-43791564 AAATCTGCCTCTTAAACTCTGGG - Intergenic
975480674 4:74876608-74876630 AAAAGGGGCTCTTAAACTTCGGG + Intergenic
976970027 4:91092995-91093017 AAAAAGGCCTATTAAATTCGGGG - Intronic
979434130 4:120669188-120669210 AAAAGACACTTTTAAACTCTTGG + Intergenic
980253803 4:130350277-130350299 CAAATGGCCTGATAAACTCAAGG - Intergenic
980780149 4:137483061-137483083 AAAAGGGCCTGTTAAACTCTGGG + Intergenic
981554944 4:145982919-145982941 AAATGGGCCTCTTAAGCACTGGG - Intergenic
986346758 5:6843084-6843106 AGTAGGGTCTGTTATACTCTAGG + Intergenic
988608981 5:32707694-32707716 AAAAGGACCTCTGAAAATCTAGG + Intronic
989692430 5:44159953-44159975 AAAAGGTCCTGTTACTCCCTGGG + Intergenic
990814583 5:59768812-59768834 AAAGCAGCCTGTTAAACTATTGG + Intronic
995473831 5:112528657-112528679 AAAAGGTCCTGTTAAACTCTGGG + Intergenic
996296627 5:121925640-121925662 AAAAAGTCCTGTCAAAGTCTCGG - Intergenic
996860357 5:128058544-128058566 AAAAGGGTCTCATGAACTCTAGG - Intergenic
997499440 5:134360734-134360756 ATAAGGGCCTTTTAAATTTTGGG - Intronic
997967415 5:138369656-138369678 AAAAGCCCCAGTTAAGCTCTGGG - Intronic
998640690 5:144007194-144007216 AGAAGGACCTTTTAGACTCTTGG - Intergenic
999325239 5:150639687-150639709 AAAAAGGCATGTTAAACCCTTGG + Intronic
999838873 5:155402992-155403014 CAAAGGGCCTGTGATTCTCTTGG - Intergenic
999997531 5:157106484-157106506 AATGGGGCCTGTTAAACTTTAGG + Intronic
1000161967 5:158606666-158606688 AAGATGGCCTGTTGTACTCTTGG - Intergenic
1001481683 5:172093168-172093190 AAAAGGCCCTGGTAAAATTTGGG - Intronic
1002408134 5:179052422-179052444 AAAAAGCCCTGTTAAATTCCGGG - Intergenic
1005870326 6:29970691-29970713 AAAAGGGCCTATTACACACTGGG + Intergenic
1006321267 6:33320961-33320983 CAATGCGCCTGTTAACCTCTGGG + Exonic
1006569266 6:34987167-34987189 CAAAGGGCCTGTTTACCTCTTGG + Intronic
1008583086 6:52923752-52923774 AAAAGGGCCTGTTAAACTTTAGG + Intergenic
1010487501 6:76433021-76433043 AAAAGGTCTTTTGAAACTCTTGG - Intergenic
1010711576 6:79181193-79181215 AAATGGGCTTGGTAAACACTAGG + Intergenic
1011565349 6:88666942-88666964 AAAAAGGCCTATTGAACTCAGGG + Intronic
1012030857 6:94060680-94060702 AAAAGGGCATATTAAATGCTAGG + Intergenic
1012611691 6:101227135-101227157 AAAAAGGCCTGTTGAACTCTGGG - Intergenic
1012658206 6:101852876-101852898 AAAAGGGTATGATAACCTCTTGG + Intronic
1012999751 6:106010200-106010222 AAGAGTGCCTGTCAGACTCTTGG - Intergenic
1015356023 6:132277913-132277935 AAAAGGGCAAATTTAACTCTTGG + Intergenic
1016560905 6:145394362-145394384 AAAACTGCCTGATACACTCTGGG + Intergenic
1018993696 6:168694286-168694308 AAAATGGCCTTGTAAGCTCTTGG - Intergenic
1020307023 7:6843224-6843246 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1020311499 7:6872068-6872090 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1020323067 7:6954406-6954428 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1022641232 7:32185461-32185483 AAAATTGCCTATAAAACTCTTGG + Intronic
1023145420 7:37146218-37146240 TAGAGGGCCTGTTAAACCCCAGG + Intronic
1027605772 7:80296916-80296938 AACAGGGCCTGTTGAATTCTTGG + Intergenic
1029078177 7:97952168-97952190 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1029661313 7:101963955-101963977 TAAAGGGCCTGTTAAAATATTGG - Intronic
1032170774 7:129582841-129582863 AAAAAGGCCTGTTGAACTCTGGG + Intergenic
1036082476 8:5572778-5572800 AAAAAGGGCTTTAAAACTCTGGG + Intergenic
1036239831 8:7072335-7072357 AGAAGGGCCTATTGAACTCTGGG + Intergenic
1036262046 8:7248819-7248841 AAAAGGGCCTATTGAATTCTGGG - Intergenic
1036304545 8:7590739-7590761 AAAAGGGCCTATTGAATTCTGGG + Intergenic
1036314085 8:7707358-7707380 AAAAGGGCCTATTGAATTCTGGG - Intergenic
1036355398 8:8038731-8038753 AAAAGGGCCTATTGAATTCTGGG + Intergenic
1036372997 8:8176576-8176598 AAAAGGGCTTATTGAACTCTGGG + Intergenic
1036877908 8:12489065-12489087 AAAAGGGCTTATTGAACTCTGGG - Intergenic
1036903502 8:12689230-12689252 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1036906002 8:12708909-12708931 AAAAAGGCCTGCTGAACTCTGGG - Intergenic
1038799126 8:30733384-30733406 AAAAGGGCCTATTGAACTCTGGG + Intronic
1039278386 8:35956284-35956306 AAAAAGGCCTATTAAACTCTGGG + Intergenic
1040145574 8:44038721-44038743 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040153614 8:44158005-44158027 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040153957 8:44163106-44163128 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040165346 8:44331637-44331659 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040172058 8:44431054-44431076 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040172232 8:44433604-44433626 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040172693 8:44440409-44440431 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040173121 8:44446702-44446724 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040175048 8:44475273-44475295 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040175984 8:44489042-44489064 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040179446 8:44540216-44540238 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040179864 8:44546507-44546529 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040183132 8:44594959-44594981 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040187552 8:44660250-44660272 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040189342 8:44686740-44686762 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040194474 8:44762582-44762604 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040201497 8:44866775-44866797 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040209366 8:44983627-44983649 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040210840 8:45005526-45005548 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040214148 8:45054308-45054330 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040214712 8:45062636-45062658 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040220586 8:45149475-45149497 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040233060 8:45333414-45333436 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040238790 8:45417777-45417799 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040240175 8:45438311-45438333 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040241420 8:45456653-45456675 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040255055 8:45657602-45657624 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040256036 8:45672039-45672061 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040260096 8:45731964-45731986 GAAAGGGAATGTTCAACTCTGGG - Intergenic
1040970328 8:53129041-53129063 CAAAAGGCCTATGAAACTCTTGG + Intergenic
1041008990 8:53523230-53523252 AAAAGGGCCTGTTGAACTCTGGG - Intergenic
1041446092 8:57952671-57952693 AGAAGGGCCTGTCCAGCTCTAGG + Intergenic
1042098685 8:65248658-65248680 CAAAGTGCCTGTTAACCCCTTGG + Intergenic
1042542988 8:69925470-69925492 AAAATGGCATGTTGAATTCTTGG - Intergenic
1043014000 8:74915436-74915458 AAAAGGACATGTTAAACAGTAGG + Intergenic
1043030931 8:75132329-75132351 AAAAGGGATTCTAAAACTCTTGG - Intergenic
1043231020 8:77800779-77800801 AAAAGGGGCTTTTACAGTCTTGG - Intergenic
1044834520 8:96282817-96282839 TAAAGAGCCTGTTAAAGACTAGG + Intronic
1045544555 8:103116752-103116774 AATAGTGTCTGTGAAACTCTAGG - Intergenic
1045599834 8:103700281-103700303 AAAGAGGCCTGTTAAACTAGAGG - Intronic
1045970803 8:108077868-108077890 AAAAGGAGGTGATAAACTCTGGG - Intronic
1046348888 8:112978047-112978069 AAAAGGCTCAATTAAACTCTAGG - Intronic
1047371540 8:124260098-124260120 AAAAGGGGCTGTTAATATCCGGG + Intergenic
1048100674 8:131347948-131347970 AAAAGGGCCTGTGAAAGTACAGG + Intergenic
1048873090 8:138814853-138814875 AAGAGGGCCTGATGAATTCTTGG - Intronic
1048957375 8:139548134-139548156 AAAAGGGCCGATTGAACTCTGGG - Intergenic
1050431297 9:5564681-5564703 CAAAAGGCCTGAAAAACTCTGGG - Intronic
1051222905 9:14869105-14869127 AAAGGGGCATGTTAAGATCTCGG - Exonic
1052693748 9:31849778-31849800 AAAAGTGCCATCTAAACTCTGGG - Intergenic
1053322786 9:37115227-37115249 AAAAGGGCCTGTTACACAGTAGG + Intergenic
1053445724 9:38151493-38151515 AAAAGGAACTGCTAAAGTCTAGG + Intergenic
1056785495 9:89589942-89589964 AAAAAGGCCTTTTCAACTCAGGG + Intergenic
1056917171 9:90756064-90756086 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1058427093 9:104884561-104884583 AAAATGGCCTGTTGAAATCGAGG + Exonic
1060287072 9:122263290-122263312 ACTAGGAACTGTTAAACTCTGGG + Intronic
1060713688 9:125898466-125898488 AAAAGGGCCTTTTGAATTTTAGG + Intronic
1060869420 9:127027963-127027985 AAAATGGCCTGCTAGACTCTGGG - Intronic
1062224084 9:135439216-135439238 AAAAGGGCCTATTGAACTCTGGG - Intergenic
1185790533 X:2925474-2925496 AAAAGGGCCTTTTTACCTGTTGG + Intronic
1185909965 X:3972194-3972216 AAAAGGGCCTGTTAAACTCTGGG + Intergenic
1186638993 X:11434892-11434914 AGAAGGCCCTGCTAAACTGTTGG - Intronic
1187106466 X:16248006-16248028 AAAAGGGCTTGTAAAATTCATGG + Intergenic
1187578463 X:20582865-20582887 AAAGGGGCTTGATAAACTCTTGG + Intergenic
1187697560 X:21937341-21937363 AAAACTGCTTGTTCAACTCTAGG - Intergenic
1190314772 X:49143489-49143511 AAAAAGCCCTGTTGAACGCTGGG - Intergenic
1190425841 X:50333939-50333961 AGAAGGGTCTGCTAAACTCTGGG - Intronic
1191036034 X:56027431-56027453 AAAAAGGCCTGTTAAATTCTGGG - Intergenic
1191294309 X:58843052-58843074 AAAAAGGAATGTTCAACTCTGGG - Intergenic
1191295830 X:58863623-58863645 AAAAAGGAATGTTCAACTCTGGG - Intergenic
1191345305 X:59524445-59524467 AAAAGGGAATGTTCAACTCTGGG - Intergenic
1191373505 X:59901399-59901421 AAAAAGGAATGTTCAACTCTGGG - Intergenic
1191396278 X:60205684-60205706 AAAAGGGAATGTTCAACTCTGGG - Intergenic
1191505763 X:61671406-61671428 AAAAGGGAATGTTCAACTCTGGG - Intergenic
1191508062 X:61702251-61702273 AAAAAGGAATGTTCAACTCTGGG - Intergenic
1191517369 X:61827033-61827055 AAAAGGGAATGTTCAACTCTGGG - Intergenic
1191555206 X:62333043-62333065 AAAAAGGAATGTTCAACTCTGGG - Intergenic
1192309196 X:69995965-69995987 AAAAAGGCTTGTTGAAATCTAGG - Intronic
1192502316 X:71662239-71662261 AAAAGGGCGGGTTCATCTCTTGG - Intergenic
1194400553 X:93434467-93434489 AAAAGGGTCTATTGAACTCTGGG + Intergenic
1195682082 X:107554783-107554805 AAATGGGCTTGTTAAACTTTAGG - Intronic
1198469639 X:136934374-136934396 AAAAGGGCCTGTTAAACTCTAGG - Intergenic
1198518879 X:137433054-137433076 AAAAGGGCCTTTAAAAATCTTGG + Intergenic
1198970070 X:142269949-142269971 AAAAAGCCCTGTTAAATTCCGGG + Intergenic
1199321832 X:146448643-146448665 AAAACAGCTTGTTAAACTCCTGG + Intergenic
1200394077 X:155972907-155972929 AAAAGGGCCTGTTAAACTCTAGG - Intergenic
1200948289 Y:8867424-8867446 AAAAGGGCCTATAGAACTCTGGG + Intergenic
1201283798 Y:12362494-12362516 AAAAGGGCCTTTTTACCTGTTGG - Intergenic
1201555105 Y:15259041-15259063 AAAAGGGTCTGTTAAACTCTGGG + Intergenic
1202037303 Y:20647988-20648010 AAAAAGGCCTGTTGAACACTGGG + Intergenic