ID: 1098753169

View in Genome Browser
Species Human (GRCh38)
Location 12:74321860-74321882
Sequence TTATAGGCTCAGAACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098753162_1098753169 17 Left 1098753162 12:74321820-74321842 CCTACTGGAAGGTAGGCATGTGT No data
Right 1098753169 12:74321860-74321882 TTATAGGCTCAGAACTGGGGAGG No data
1098753161_1098753169 18 Left 1098753161 12:74321819-74321841 CCCTACTGGAAGGTAGGCATGTG No data
Right 1098753169 12:74321860-74321882 TTATAGGCTCAGAACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098753169 Original CRISPR TTATAGGCTCAGAACTGGGG AGG Intergenic
No off target data available for this crispr