ID: 1098758014

View in Genome Browser
Species Human (GRCh38)
Location 12:74389578-74389600
Sequence CCCTCCAGCCCCACTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098758014_1098758018 -2 Left 1098758014 12:74389578-74389600 CCTGGAGGAGTGGGGCTGGAGGG No data
Right 1098758018 12:74389599-74389621 GGAGCTGGCTTCTCTGCTGGCGG No data
1098758014_1098758019 7 Left 1098758014 12:74389578-74389600 CCTGGAGGAGTGGGGCTGGAGGG No data
Right 1098758019 12:74389608-74389630 TTCTCTGCTGGCGGTGCCTCTGG No data
1098758014_1098758017 -5 Left 1098758014 12:74389578-74389600 CCTGGAGGAGTGGGGCTGGAGGG No data
Right 1098758017 12:74389596-74389618 GAGGGAGCTGGCTTCTCTGCTGG No data
1098758014_1098758020 8 Left 1098758014 12:74389578-74389600 CCTGGAGGAGTGGGGCTGGAGGG No data
Right 1098758020 12:74389609-74389631 TCTCTGCTGGCGGTGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098758014 Original CRISPR CCCTCCAGCCCCACTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr