ID: 1098759963

View in Genome Browser
Species Human (GRCh38)
Location 12:74410989-74411011
Sequence CTGAAAATATCCATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098759963_1098759966 20 Left 1098759963 12:74410989-74411011 CCATTGTCCATGGATATTTTCAG No data
Right 1098759966 12:74411032-74411054 TTCTGTATCAATTTAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098759963 Original CRISPR CTGAAAATATCCATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr