ID: 1098761311

View in Genome Browser
Species Human (GRCh38)
Location 12:74428651-74428673
Sequence ATAGCAACACAGATGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098761304_1098761311 25 Left 1098761304 12:74428603-74428625 CCAAATAAACCTTCTATTTATAA No data
Right 1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG No data
1098761307_1098761311 -2 Left 1098761307 12:74428630-74428652 CCCAGCTTTAGGTATTCCTTTAT No data
Right 1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG No data
1098761305_1098761311 16 Left 1098761305 12:74428612-74428634 CCTTCTATTTATAAATTACCCAG No data
Right 1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG No data
1098761308_1098761311 -3 Left 1098761308 12:74428631-74428653 CCAGCTTTAGGTATTCCTTTATA No data
Right 1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098761311 Original CRISPR ATAGCAACACAGATGGAATA AGG Intergenic
No off target data available for this crispr