ID: 1098761573

View in Genome Browser
Species Human (GRCh38)
Location 12:74431843-74431865
Sequence GCTTCCAGGCATGCACGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098761573_1098761578 11 Left 1098761573 12:74431843-74431865 CCTTCACGTGCATGCCTGGAAGC No data
Right 1098761578 12:74431877-74431899 CTTCCCTGGGATCTCAGCTGAGG No data
1098761573_1098761575 -3 Left 1098761573 12:74431843-74431865 CCTTCACGTGCATGCCTGGAAGC No data
Right 1098761575 12:74431863-74431885 AGCAGATCCTGTCTCTTCCCTGG No data
1098761573_1098761576 -2 Left 1098761573 12:74431843-74431865 CCTTCACGTGCATGCCTGGAAGC No data
Right 1098761576 12:74431864-74431886 GCAGATCCTGTCTCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098761573 Original CRISPR GCTTCCAGGCATGCACGTGA AGG (reversed) Intergenic
No off target data available for this crispr