ID: 1098770387

View in Genome Browser
Species Human (GRCh38)
Location 12:74545050-74545072
Sequence GTGATGACATCAACTCTGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098770384_1098770387 9 Left 1098770384 12:74545018-74545040 CCCTACTCAGTATGATTAAATTT 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1098770387 12:74545050-74545072 GTGATGACATCAACTCTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 151
1098770385_1098770387 8 Left 1098770385 12:74545019-74545041 CCTACTCAGTATGATTAAATTTT 0: 1
1: 0
2: 4
3: 30
4: 300
Right 1098770387 12:74545050-74545072 GTGATGACATCAACTCTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 151
1098770383_1098770387 17 Left 1098770383 12:74545010-74545032 CCAATTTACCCTACTCAGTATGA 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1098770387 12:74545050-74545072 GTGATGACATCAACTCTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098770387 Original CRISPR GTGATGACATCAACTCTGAA AGG Exonic
902111210 1:14079996-14080018 ATGATCCCATCAACTCTCAAAGG + Intergenic
902663076 1:17918869-17918891 GTGATGACATCAAGTAAGTAAGG + Intergenic
905806244 1:40879888-40879910 GTGAGGACATCAACTTTGCTAGG - Intergenic
907917221 1:58882218-58882240 GTGATGAAATTATGTCTGAAGGG - Intergenic
908779694 1:67678886-67678908 ATGAGGAAAACAACTCTGAAAGG - Intergenic
909530320 1:76674922-76674944 GTGATGTCATCATCTTGGAAGGG - Intergenic
909541890 1:76800824-76800846 GAGATGTTTTCAACTCTGAAAGG - Intergenic
911076079 1:93876687-93876709 GTGAAGACATGAACAGTGAAGGG - Exonic
911456825 1:98135609-98135631 GGGATGACAGCAGATCTGAAAGG - Intergenic
914912197 1:151796563-151796585 GTGCTAACATCCACTTTGAACGG + Intergenic
915084948 1:153380042-153380064 GACATGACATCATCTCTGTAGGG + Intergenic
917333967 1:173909770-173909792 GTGATGTCATCACCTTTGAAGGG + Exonic
921052938 1:211524034-211524056 GTGATCAAATCTACTCTGCAAGG - Intergenic
921387117 1:214580704-214580726 TTAAAGACATCTACTCTGAATGG - Intergenic
924484326 1:244465868-244465890 ATAATGAGATCAACTCTGGAGGG - Intronic
1063991990 10:11576439-11576461 GTGATTTAATCAACTCTCAAAGG - Intronic
1065141655 10:22724240-22724262 GTTGTGACATCAACTCTCTAAGG - Intergenic
1069635600 10:69922989-69923011 GGGAAGACATCTCCTCTGAAAGG - Intronic
1071199793 10:83207917-83207939 TTGAAGAAAGCAACTCTGAATGG - Intergenic
1073727647 10:106252887-106252909 GTGATGACACCAACTGTGCATGG - Intergenic
1076207210 10:128612824-128612846 GTGATGACGTCATCTGTGCAGGG - Intergenic
1078001682 11:7501570-7501592 GTGATGTCATGACCACTGAAAGG + Intronic
1079259200 11:18861728-18861750 GTGATGTCATCAGTTCAGAATGG - Intergenic
1080258219 11:30317104-30317126 GAGATGGCATGTACTCTGAAAGG - Intergenic
1085651642 11:78273697-78273719 GTGATGACATGAGATTTGAAAGG + Intronic
1085810649 11:79677976-79677998 GTGATACCATCACCTCTGACAGG - Intergenic
1086486910 11:87315012-87315034 GTGAAGACATAAACTCTAATTGG - Intronic
1086581063 11:88399104-88399126 GTTATGAAATGAACTCTTAATGG + Intergenic
1090435838 11:126685767-126685789 GTGAGGGCAACAGCTCTGAATGG - Intronic
1090763938 11:129860792-129860814 GCTGTGACTTCAACTCTGAAAGG - Intergenic
1091075332 11:132610416-132610438 GTGATGACATCAACGAAGATGGG - Intronic
1093731226 12:22568019-22568041 GTGATGAAAGCAACTCTCAGCGG + Intergenic
1093731383 12:22569151-22569173 GTGATGAAAACAACTCTCAGTGG - Intergenic
1098770387 12:74545050-74545072 GTGATGACATCAACTCTGAAAGG + Exonic
1100578705 12:95918196-95918218 GTGGTGAGATTAACTCTGCAAGG + Intronic
1101390742 12:104297679-104297701 ATGATGACAACCACTCTGTATGG + Intronic
1102026969 12:109719195-109719217 GTTATGACGTAAACTCTGGAAGG - Intronic
1102545438 12:113651488-113651510 TTGATGAAATGAACTCTGAAGGG - Intergenic
1102599525 12:114018822-114018844 GTGATTAAATAAACACTGAATGG - Intergenic
1103988480 12:124782711-124782733 CTGATGACATCAGCTCCCAAGGG - Exonic
1104588309 12:130064646-130064668 GTGAGGAGATCAATCCTGAAGGG + Intergenic
1105829802 13:24153969-24153991 ATGTTCACATCAACTCTGAGCGG + Intronic
1108928477 13:55784350-55784372 GTGGTGACATTTACTTTGAATGG - Intergenic
1110068115 13:71134693-71134715 GTGATGACATAGATTCTCAAGGG - Intergenic
1116376095 14:44202818-44202840 TTAATGACAGCAATTCTGAAAGG + Intergenic
1117874238 14:60235120-60235142 GTGATGACACCTACCTTGAAGGG + Intergenic
1127838400 15:62809237-62809259 ATGATTACATCATTTCTGAAGGG - Intronic
1127885544 15:63196517-63196539 GAGCTCACAGCAACTCTGAAAGG - Intronic
1129659683 15:77546107-77546129 CTGATGACCTCTACCCTGAATGG - Intergenic
1130613638 15:85382919-85382941 GTGATGACATTTACTTTAAAAGG + Intronic
1135138350 16:19901240-19901262 GTGATCTCATCACCTCTTAAAGG - Intergenic
1135547411 16:23375453-23375475 GTGAGGACCCCAGCTCTGAATGG + Intronic
1138807074 16:60102817-60102839 GTGATGAAATGAGCTCTCAATGG + Intergenic
1139504331 16:67391566-67391588 GTGAGGACAGCATCTCTGTAAGG + Exonic
1140133415 16:72183900-72183922 CTGGTGGCAGCAACTCTGAATGG + Intergenic
1140821026 16:78663416-78663438 GGAATGACATGAACTGTGAATGG - Intronic
1143656536 17:8297256-8297278 ATGATGACAACAACACTGATGGG - Intergenic
1144020189 17:11234207-11234229 TTGATGACATCAGCTAGGAATGG + Intergenic
1144303765 17:13948518-13948540 GTGAAGACATAATCTATGAAAGG + Intergenic
1149057148 17:52379888-52379910 GTGATGAAAGCAACTCTCAGTGG - Intergenic
1149064902 17:52467671-52467693 GTGTGTACATCAACTCTGAGTGG - Intergenic
1155210140 18:23593404-23593426 GTGATGATATCGACTGGGAAAGG - Intergenic
1156812061 18:41264429-41264451 GTGAAGGCATCATCACTGAAAGG - Intergenic
1158496709 18:57961612-57961634 GTGGTGAAGTCAACTGTGAAAGG + Intergenic
1158893247 18:61892831-61892853 GTGATGACATCAAGTGGAAATGG + Exonic
1159425184 18:68275731-68275753 GTAATGACATCACCTCTGAAAGG + Intergenic
1164472095 19:28544819-28544841 GTTCTGAGATCCACTCTGAATGG - Intergenic
1165587832 19:36935946-36935968 GTGTTACCATTAACTCTGAATGG - Intronic
1167445657 19:49535727-49535749 GTGATCACAGCTACTCTGGAGGG + Intronic
925895186 2:8465952-8465974 GGGATGACAACCAATCTGAAGGG - Intergenic
926614745 2:14984697-14984719 GTGATCACATCAACTCTTCTGGG - Intergenic
934621795 2:95814769-95814791 GTGATGGCATCAGCTGAGAAGGG - Intergenic
934811652 2:97284044-97284066 GTGATGGCATCAGCTGAGAAGGG + Intergenic
934826039 2:97423896-97423918 GTGATGGCATCAGCTGAGAAGGG - Intergenic
935359720 2:102237221-102237243 GAGATGCCCTCAAATCTGAATGG + Intronic
939135755 2:138291326-138291348 TTGAAGACATCAATTGTGAATGG - Intergenic
940434439 2:153634412-153634434 TTGATGACATCTACTCTGAGAGG + Intergenic
941084038 2:161095629-161095651 CTGAAGAAATCAATTCTGAATGG + Intergenic
941612014 2:167673202-167673224 GTGATGACATGAAGTATGAGAGG + Intergenic
945176314 2:207047237-207047259 GAGATGACCTGAAATCTGAACGG - Intergenic
1169069389 20:2713752-2713774 GTGTGGACATCAATTCTGATGGG + Intronic
1170439435 20:16363651-16363673 GTGATGACAGAAACACAGAAGGG - Intronic
1170610999 20:17913261-17913283 GAGATGATATGAACTCTTAAGGG + Intergenic
1171036393 20:21715489-21715511 GGGGTGACATCATCTCAGAAGGG - Exonic
1172873222 20:38148486-38148508 GGGCTGACATCAGCTCTGCAGGG - Intronic
1173076324 20:39823260-39823282 ATGAGGACTTCAACTATGAAAGG + Intergenic
1173675671 20:44832958-44832980 GTGATGACATCAGGTCTCCAGGG + Intergenic
1173934973 20:46853408-46853430 GTGATGACAACAATTCAGATAGG - Intergenic
1181137894 22:20781889-20781911 GAGATGACACCCACTCTGACAGG + Intronic
1181622156 22:24098488-24098510 GACATGACATCTACTTTGAAAGG + Intronic
949598000 3:5567887-5567909 GTGATGACCACAACTTTGAGAGG + Intergenic
950254468 3:11493148-11493170 GTGATGAGATCAGCTCTCAGTGG + Intronic
951417493 3:22442829-22442851 GTGCTGACATTATTTCTGAAAGG + Intergenic
952261822 3:31747558-31747580 GTGATGCCAGCAAGTCTGAAAGG + Intronic
956433023 3:69206531-69206553 GTCATTACATCAGCTCTGGAAGG - Intronic
956813146 3:72884442-72884464 GACATGACATCATCTCTGTAGGG - Intergenic
962430167 3:135311752-135311774 GTGATGACATGAACTCAATAAGG - Intergenic
962752818 3:138446442-138446464 GAGATGACATGAACTCAAAACGG + Intronic
963452487 3:145501418-145501440 GTGATGACATCATTGCTTAATGG + Intergenic
963935868 3:151052648-151052670 GTAATGACAGCAACTCTATATGG + Intergenic
964419772 3:156489184-156489206 GTGATTTCATCAATTCTCAAGGG - Intronic
966413569 3:179666995-179667017 GTGATTACAACAACCCTGCAAGG - Intronic
966790681 3:183666663-183666685 GTGATGACATTAATGCTCAAAGG - Intronic
967189998 3:186976746-186976768 GTAATGACACCTACTTTGAAAGG - Intronic
969425656 4:7122376-7122398 ATGATGTCCTCACCTCTGAATGG + Intergenic
971073450 4:23121605-23121627 GGGATGAAATCAATTCAGAAAGG - Intergenic
971597589 4:28551254-28551276 GTGATAGAAGCAACTCTGAAAGG - Intergenic
971868402 4:32203702-32203724 ATGATGTCATCACCTCTAAAAGG - Intergenic
974541514 4:63244712-63244734 GTGATGACATGAAATGTGCAGGG - Intergenic
977067365 4:92334670-92334692 GTGATGTAATCAGCTCTTAAAGG + Intronic
980743405 4:136981664-136981686 GTGATCCCTGCAACTCTGAACGG + Intergenic
981083591 4:140660175-140660197 GTGAGGACTCCAAGTCTGAAAGG - Intronic
982320994 4:154077602-154077624 GTGATAACATAAACACAGAAAGG + Intergenic
982471915 4:155802637-155802659 GTGATGACATGGCCTCTGGAGGG - Intronic
983694494 4:170511279-170511301 TTGATTACATCAGATCTGAAAGG + Intergenic
986927057 5:12767317-12767339 TTGATGAAATCAACTCTTCATGG + Intergenic
988100983 5:26677809-26677831 GTAAACACATCAACTCTGACAGG + Intergenic
990072859 5:51806491-51806513 ATGATGACTTCAAATTTGAAGGG + Intergenic
990719047 5:58672532-58672554 GTGAGGAATTAAACTCTGAAAGG + Intronic
990801630 5:59610784-59610806 GTGAAGACATGAAGTCTGTAAGG + Intronic
992192873 5:74311324-74311346 GTGATGAGATCAATTCTGAATGG + Intergenic
995056568 5:107765875-107765897 GTGATTATATCAATTCTAAATGG - Intergenic
996460302 5:123733339-123733361 GTGAGGACATGAAATTTGAAGGG + Intergenic
996898473 5:128515333-128515355 ATGATGACAACTTCTCTGAAAGG - Intronic
999642986 5:153690424-153690446 GTCATTACATCATCTCTAAAAGG + Intronic
1000156410 5:158556533-158556555 GTGATCACATCAATCCTCAATGG + Intergenic
1000473351 5:161674155-161674177 GAGAAGACATTAACTCTTAAAGG - Intronic
1000631429 5:163595316-163595338 GTTATGAAAACAACTCTGTAGGG + Intergenic
1000659212 5:163917829-163917851 GAGTTGACAGCAACTCTGGAAGG + Intergenic
1000832278 5:166117616-166117638 TTGATGACATCATATCTGAATGG - Intergenic
1003677220 6:8216386-8216408 GTGAACACAGCAACTCTGCATGG - Intergenic
1006068472 6:31479361-31479383 GTGAAGACACAAACTCTGAGAGG - Intergenic
1017047021 6:150356412-150356434 GTGATGAAAACAACTCTCAATGG + Intergenic
1018948122 6:168360188-168360210 GTGATAACATGAAGACTGAAGGG + Intergenic
1021928585 7:25556849-25556871 GTTATGACATTTCCTCTGAAGGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1028382610 7:90215276-90215298 TGGATGACAGCAACTCTGAAAGG - Intronic
1032460101 7:132103910-132103932 GTTATGCCATAAGCTCTGAAGGG + Intergenic
1033878649 7:145854845-145854867 GTGATGTCAAAAACTGTGAAGGG - Intergenic
1035636267 8:1146794-1146816 GTGGGGACTTGAACTCTGAAAGG - Intergenic
1036610099 8:10342357-10342379 GTGATGACATCAACACTCGATGG - Intronic
1036683445 8:10892884-10892906 GTGATGACAGCTGCTCTGGATGG - Intergenic
1038909444 8:31946618-31946640 ATGATTACACCAACCCTGAATGG + Intronic
1041057358 8:54000655-54000677 GGGATGATCTCAACTTTGAAGGG - Intronic
1041775382 8:61516954-61516976 GTGATAACATCTACTTTGCAGGG - Intronic
1042836954 8:73087666-73087688 CTGATGACATCATATCTGGAGGG - Intronic
1044746509 8:95376156-95376178 ATGATGACATAAAGTCTGAGTGG + Intergenic
1044993724 8:97819152-97819174 GACATGACATCATCTCTGTAGGG - Exonic
1046176333 8:110579990-110580012 CTGATCCCATCAACTCTCAAAGG + Intergenic
1046405989 8:113772941-113772963 ATGATGATCTCAACTTTGAAAGG - Intergenic
1048174889 8:132142706-132142728 GTGATCAAATCAGCTCTGCATGG + Intronic
1048514140 8:135090495-135090517 ATGAGGAAATCAATTCTGAAAGG + Intergenic
1052552734 9:29971255-29971277 GTGATGATATCTACTTTTAATGG + Intergenic
1055558189 9:77497006-77497028 GTGATTACATTACCTCTGGAGGG - Intronic
1058230057 9:102414638-102414660 GTGATGATATTGAGTCTGAAAGG - Intergenic
1060725496 9:126003223-126003245 GGGATGTCATCAAGTCTCAAAGG - Intergenic
1192191138 X:68991833-68991855 GTGATGGCACCAACTCCAAAGGG + Intergenic
1192733130 X:73821017-73821039 GTGATGCCAGAAACTGTGAAAGG + Intergenic
1195514527 X:105758281-105758303 GTGAAGACATTAAATATGAATGG - Intronic
1195946377 X:110217380-110217402 CTGAGTACATCAACTCTGATTGG + Intronic
1197503391 X:127270358-127270380 GTGATTACATCAACTTTTCATGG - Intergenic
1198042964 X:132872616-132872638 GTGATCATATAAACTCTGTAAGG + Intronic
1201500696 Y:14639732-14639754 TTGATGCCAACATCTCTGAAGGG - Intronic