ID: 1098771725

View in Genome Browser
Species Human (GRCh38)
Location 12:74560778-74560800
Sequence CAGGGAAAACAGAGTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098771723_1098771725 -6 Left 1098771723 12:74560761-74560783 CCTTCTTCATAATGTGGCAGGGA No data
Right 1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098771725 Original CRISPR CAGGGAAAACAGAGTGTGCA GGG Intergenic
No off target data available for this crispr