ID: 1098776147

View in Genome Browser
Species Human (GRCh38)
Location 12:74620259-74620281
Sequence TTGTGGGGAAGGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098776147_1098776162 25 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776162 12:74620307-74620329 TGGGCTGGAATTTACACCATAGG No data
1098776147_1098776160 6 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776160 12:74620288-74620310 GTTCTCAGCTTTTCAGACATGGG No data
1098776147_1098776159 5 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776159 12:74620287-74620309 GGTTCTCAGCTTTTCAGACATGG No data
1098776147_1098776163 28 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776163 12:74620310-74620332 GCTGGAATTTACACCATAGGTGG No data
1098776147_1098776161 10 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098776147 Original CRISPR TTGTGGGGAAGGAGGGATGA GGG (reversed) Intergenic
No off target data available for this crispr