ID: 1098776161

View in Genome Browser
Species Human (GRCh38)
Location 12:74620292-74620314
Sequence TCAGCTTTTCAGACATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098776146_1098776161 22 Left 1098776146 12:74620247-74620269 CCAGAACTTATACCCTCATCCCT No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776151_1098776161 2 Left 1098776151 12:74620267-74620289 CCTCCTTCCCCACAACCCCTGGT No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776147_1098776161 10 Left 1098776147 12:74620259-74620281 CCCTCATCCCTCCTTCCCCACAA No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776148_1098776161 9 Left 1098776148 12:74620260-74620282 CCTCATCCCTCCTTCCCCACAAC No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776154_1098776161 -6 Left 1098776154 12:74620275-74620297 CCCACAACCCCTGGTTCTCAGCT No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776155_1098776161 -7 Left 1098776155 12:74620276-74620298 CCACAACCCCTGGTTCTCAGCTT No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776149_1098776161 3 Left 1098776149 12:74620266-74620288 CCCTCCTTCCCCACAACCCCTGG No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776152_1098776161 -1 Left 1098776152 12:74620270-74620292 CCTTCCCCACAACCCCTGGTTCT No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data
1098776153_1098776161 -5 Left 1098776153 12:74620274-74620296 CCCCACAACCCCTGGTTCTCAGC No data
Right 1098776161 12:74620292-74620314 TCAGCTTTTCAGACATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098776161 Original CRISPR TCAGCTTTTCAGACATGGGC TGG Intergenic
No off target data available for this crispr