ID: 1098780070

View in Genome Browser
Species Human (GRCh38)
Location 12:74676195-74676217
Sequence CTGGTTAGACAGTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098780065_1098780070 -4 Left 1098780065 12:74676176-74676198 CCGGCTCATCTCACTGAGACTGG No data
Right 1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG No data
1098780064_1098780070 9 Left 1098780064 12:74676163-74676185 CCAACTGAGGTATCCGGCTCATC 0: 4
1: 80
2: 492
3: 2512
4: 4205
Right 1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098780070 Original CRISPR CTGGTTAGACAGTGGGTGCA GGG Intergenic
No off target data available for this crispr