ID: 1098786261

View in Genome Browser
Species Human (GRCh38)
Location 12:74760243-74760265
Sequence TCACATAAACTTAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098786261_1098786265 26 Left 1098786261 12:74760243-74760265 CCCTCTACCTTAAGTTTATGTGA No data
Right 1098786265 12:74760292-74760314 GAAGACAGTAGATACTTGGTTGG 0: 13
1: 144
2: 310
3: 411
4: 476
1098786261_1098786264 22 Left 1098786261 12:74760243-74760265 CCCTCTACCTTAAGTTTATGTGA No data
Right 1098786264 12:74760288-74760310 TCTTGAAGACAGTAGATACTTGG 0: 14
1: 163
2: 319
3: 537
4: 1202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098786261 Original CRISPR TCACATAAACTTAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr