ID: 1098786261 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:74760243-74760265 |
| Sequence | TCACATAAACTTAAGGTAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098786261_1098786265 | 26 | Left | 1098786261 | 12:74760243-74760265 | CCCTCTACCTTAAGTTTATGTGA | No data | ||
| Right | 1098786265 | 12:74760292-74760314 | GAAGACAGTAGATACTTGGTTGG | 0: 13 1: 144 2: 310 3: 411 4: 476 |
||||
| 1098786261_1098786264 | 22 | Left | 1098786261 | 12:74760243-74760265 | CCCTCTACCTTAAGTTTATGTGA | No data | ||
| Right | 1098786264 | 12:74760288-74760310 | TCTTGAAGACAGTAGATACTTGG | 0: 14 1: 163 2: 319 3: 537 4: 1202 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098786261 | Original CRISPR | TCACATAAACTTAAGGTAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||