ID: 1098798029

View in Genome Browser
Species Human (GRCh38)
Location 12:74918063-74918085
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098798027_1098798029 6 Left 1098798027 12:74918034-74918056 CCAAGAAAACAATATGTACTCAT No data
Right 1098798029 12:74918063-74918085 ACATGAGTACATAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098798029 Original CRISPR ACATGAGTACATAAGGAACA TGG Intergenic
No off target data available for this crispr