ID: 1098798954

View in Genome Browser
Species Human (GRCh38)
Location 12:74928578-74928600
Sequence ATGTTCAGAAGTAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098798954_1098798956 1 Left 1098798954 12:74928578-74928600 CCAACAATTCTACTTCTGAACAT No data
Right 1098798956 12:74928602-74928624 TATCCAAAGGAAATGAAATCAGG 0: 13
1: 73
2: 197
3: 561
4: 1454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098798954 Original CRISPR ATGTTCAGAAGTAGAATTGT TGG (reversed) Intergenic
No off target data available for this crispr