ID: 1098799403

View in Genome Browser
Species Human (GRCh38)
Location 12:74934857-74934879
Sequence GCTCCATCTTACAACCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098799403_1098799405 22 Left 1098799403 12:74934857-74934879 CCATTATGGTTGTAAGATGGAGC No data
Right 1098799405 12:74934902-74934924 TATGTCCAGCACTTTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098799403 Original CRISPR GCTCCATCTTACAACCATAA TGG (reversed) Intergenic
No off target data available for this crispr