ID: 1098800086

View in Genome Browser
Species Human (GRCh38)
Location 12:74945647-74945669
Sequence TTTTCTACACAAAGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098800084_1098800086 -9 Left 1098800084 12:74945633-74945655 CCTGCTATGATCTGTTTTCTACA No data
Right 1098800086 12:74945647-74945669 TTTTCTACACAAAGGCAGCCAGG No data
1098800083_1098800086 -8 Left 1098800083 12:74945632-74945654 CCCTGCTATGATCTGTTTTCTAC No data
Right 1098800086 12:74945647-74945669 TTTTCTACACAAAGGCAGCCAGG No data
1098800082_1098800086 10 Left 1098800082 12:74945614-74945636 CCTCTTTCAATTTTCAGACCCTG No data
Right 1098800086 12:74945647-74945669 TTTTCTACACAAAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098800086 Original CRISPR TTTTCTACACAAAGGCAGCC AGG Intergenic
No off target data available for this crispr