ID: 1098800683

View in Genome Browser
Species Human (GRCh38)
Location 12:74953578-74953600
Sequence ACTGCAGGCGCAGATCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098800683_1098800686 -10 Left 1098800683 12:74953578-74953600 CCACCAAGATCTGCGCCTGCAGT No data
Right 1098800686 12:74953591-74953613 CGCCTGCAGTGGCTCCACCCAGG No data
1098800683_1098800692 8 Left 1098800683 12:74953578-74953600 CCACCAAGATCTGCGCCTGCAGT No data
Right 1098800692 12:74953609-74953631 CCAGGCCCATGTTCTATTAAGGG No data
1098800683_1098800695 20 Left 1098800683 12:74953578-74953600 CCACCAAGATCTGCGCCTGCAGT No data
Right 1098800695 12:74953621-74953643 TCTATTAAGGGACATTGCAATGG No data
1098800683_1098800690 7 Left 1098800683 12:74953578-74953600 CCACCAAGATCTGCGCCTGCAGT No data
Right 1098800690 12:74953608-74953630 CCCAGGCCCATGTTCTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098800683 Original CRISPR ACTGCAGGCGCAGATCTTGG TGG (reversed) Intergenic
No off target data available for this crispr