ID: 1098801070

View in Genome Browser
Species Human (GRCh38)
Location 12:74958908-74958930
Sequence TATAACATGGAGAAGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098801070_1098801073 -8 Left 1098801070 12:74958908-74958930 CCAAACCACTTCTCCATGTTATA No data
Right 1098801073 12:74958923-74958945 ATGTTATAGCTCATGACTGAAGG No data
1098801070_1098801076 8 Left 1098801070 12:74958908-74958930 CCAAACCACTTCTCCATGTTATA No data
Right 1098801076 12:74958939-74958961 CTGAAGGGCAGCCATTTCTTGGG No data
1098801070_1098801074 -7 Left 1098801070 12:74958908-74958930 CCAAACCACTTCTCCATGTTATA No data
Right 1098801074 12:74958924-74958946 TGTTATAGCTCATGACTGAAGGG No data
1098801070_1098801075 7 Left 1098801070 12:74958908-74958930 CCAAACCACTTCTCCATGTTATA No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098801070 Original CRISPR TATAACATGGAGAAGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr