ID: 1098801075

View in Genome Browser
Species Human (GRCh38)
Location 12:74958938-74958960
Sequence ACTGAAGGGCAGCCATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098801071_1098801075 2 Left 1098801071 12:74958913-74958935 CCACTTCTCCATGTTATAGCTCA No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data
1098801068_1098801075 26 Left 1098801068 12:74958889-74958911 CCTTTTAAGAGAAATTATCCCAA No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data
1098801072_1098801075 -6 Left 1098801072 12:74958921-74958943 CCATGTTATAGCTCATGACTGAA No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data
1098801070_1098801075 7 Left 1098801070 12:74958908-74958930 CCAAACCACTTCTCCATGTTATA No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data
1098801069_1098801075 8 Left 1098801069 12:74958907-74958929 CCCAAACCACTTCTCCATGTTAT No data
Right 1098801075 12:74958938-74958960 ACTGAAGGGCAGCCATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098801075 Original CRISPR ACTGAAGGGCAGCCATTTCT TGG Intergenic
No off target data available for this crispr