ID: 1098806859

View in Genome Browser
Species Human (GRCh38)
Location 12:75031964-75031986
Sequence TTTCCCAATTAGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098806859_1098806864 -1 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806864 12:75031986-75032008 AAAATAGGATCCTGTAAATTGGG No data
1098806859_1098806868 14 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806868 12:75032001-75032023 AAATTGGGATGGTAACATGTGGG No data
1098806859_1098806863 -2 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806863 12:75031985-75032007 AAAAATAGGATCCTGTAAATTGG No data
1098806859_1098806865 3 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG No data
1098806859_1098806867 13 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806867 12:75032000-75032022 TAAATTGGGATGGTAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098806859 Original CRISPR TTTCCCAATTAGGGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr