ID: 1098806865

View in Genome Browser
Species Human (GRCh38)
Location 12:75031990-75032012
Sequence TAGGATCCTGTAAATTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098806859_1098806865 3 Left 1098806859 12:75031964-75031986 CCATTTTTTCCCTAATTGGGAAA No data
Right 1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG No data
1098806861_1098806865 -6 Left 1098806861 12:75031973-75031995 CCCTAATTGGGAAAAAATAGGAT No data
Right 1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG No data
1098806862_1098806865 -7 Left 1098806862 12:75031974-75031996 CCTAATTGGGAAAAAATAGGATC No data
Right 1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098806865 Original CRISPR TAGGATCCTGTAAATTGGGA TGG Intergenic
No off target data available for this crispr