ID: 1098807198

View in Genome Browser
Species Human (GRCh38)
Location 12:75034984-75035006
Sequence AACAGCTCTTGGACTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098807194_1098807198 11 Left 1098807194 12:75034950-75034972 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1098807198 12:75034984-75035006 AACAGCTCTTGGACTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098807198 Original CRISPR AACAGCTCTTGGACTGGTAC TGG Intergenic
No off target data available for this crispr