ID: 1098808272

View in Genome Browser
Species Human (GRCh38)
Location 12:75049945-75049967
Sequence GTGAATTAGGTTGAGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098808270_1098808272 3 Left 1098808270 12:75049919-75049941 CCATTCTTCTTAAATAACTGCTT 0: 1
1: 0
2: 4
3: 55
4: 516
Right 1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG 0: 1
1: 0
2: 1
3: 1
4: 127
1098808269_1098808272 21 Left 1098808269 12:75049901-75049923 CCTTTGAAATGTAAGCATCCATT 0: 1
1: 0
2: 2
3: 23
4: 335
Right 1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG 0: 1
1: 0
2: 1
3: 1
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098808272 Original CRISPR GTGAATTAGGTTGAGATGCA TGG Intronic
904374306 1:30070248-30070270 GTCAATTAGGGTGAGATGAGAGG + Intergenic
908815310 1:68026094-68026116 GTCAATGAAGCTGAGATGCATGG + Intergenic
911434645 1:97841353-97841375 GTGGATTATGATGAGATGAAAGG - Intronic
916194418 1:162210204-162210226 GTGGAGTAGGCTGAGGTGCAAGG + Intronic
917665010 1:177217967-177217989 GTTAAGTAGGTTGGGATGAATGG + Intronic
923509377 1:234636648-234636670 GTGAGTTCTCTTGAGATGCAGGG + Intergenic
923714357 1:236412213-236412235 GTTCATTAGGTAAAGATGCAGGG - Intronic
924166247 1:241286429-241286451 CTGAACTAGGTTTAGATGGAAGG - Intronic
924460398 1:244253726-244253748 GTGAAAAGGGTGGAGATGCAAGG + Intergenic
1063039158 10:2318922-2318944 GTGATTGAGGTTAAGAAGCAGGG - Intergenic
1066337498 10:34493918-34493940 TTGAGTTGGGATGAGATGCATGG - Intronic
1069864917 10:71496233-71496255 TGAAATCAGGTTGAGATGCATGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077819114 11:5718494-5718516 GTGAAGTATGGAGAGATGCAAGG + Intronic
1077848500 11:6051168-6051190 GTGCCTGTGGTTGAGATGCAGGG + Intergenic
1088438902 11:109846597-109846619 GTGAATTACGATAAGACGCATGG + Intergenic
1092656670 12:10692357-10692379 GTGAAAAATGTTGAGAAGCATGG - Intergenic
1093827163 12:23707404-23707426 GTGAATTAGTCTGAGTTTCAGGG + Intronic
1098119676 12:67222781-67222803 GTTAATTGAGATGAGATGCAGGG - Intergenic
1098529226 12:71521596-71521618 CTTAATCAGGTTTAGATGCAAGG + Intronic
1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG + Intronic
1102481646 12:113227826-113227848 GAGAATTCAGTTGAGTTGCAGGG + Intronic
1105487834 13:20854816-20854838 CTGAATTAGTTTGGGAAGCATGG - Intronic
1106203719 13:27568466-27568488 GTGTATAACGGTGAGATGCATGG + Intronic
1107456006 13:40555132-40555154 GTGAATGAGCTGGAGAAGCAAGG - Intergenic
1107538707 13:41363596-41363618 GTGATTTTGGCTGAGTTGCATGG + Intronic
1108707664 13:53004588-53004610 GTGAATTAGGCTGACAACCATGG - Intergenic
1110291255 13:73809140-73809162 GAGAGTTAGGTTGAGAAGGATGG - Intronic
1120734011 14:88033497-88033519 GTAAATGAGGTAGAGATGCTAGG - Intergenic
1123104695 14:105835213-105835235 GTTATTTAGATTGAGATACATGG - Intergenic
1125870923 15:43101161-43101183 GGAAATGAGGTGGAGATGCAGGG + Intronic
1127849150 15:62897886-62897908 TTTGGTTAGGTTGAGATGCATGG + Intergenic
1128050752 15:64662362-64662384 GTGAATTAGGCTGGAGTGCAGGG + Intronic
1133718003 16:8467762-8467784 GCAAATTAGGATGAGTTGCAGGG - Intergenic
1133903772 16:10001933-10001955 TTTAATTAGGATTAGATGCAGGG + Intronic
1134148454 16:11786521-11786543 GTGTATAAGGTTGAGGTTCAAGG - Intronic
1141226271 16:82119084-82119106 GTGATTTAGGTTGACATAAATGG + Intergenic
1146225160 17:31059500-31059522 GTGAATGAAGTGGAGATGAACGG + Intergenic
1151122842 17:71811683-71811705 GTGAATGAAATTGAGATACAGGG + Intergenic
1151572251 17:74932647-74932669 GTGATTTAGGCTCAGATGCCTGG - Intronic
1153146622 18:2039811-2039833 GTGAATTAGTATCAGATCCATGG - Intergenic
1157160058 18:45305630-45305652 GTGACTTAGGCAGAGATGCCAGG - Intronic
1157191222 18:45583348-45583370 TTGGATGAGGGTGAGATGCAGGG - Intronic
1157739989 18:50083819-50083841 GTGAATGAGTTTGAGATCCCTGG - Intronic
1162415476 19:10533886-10533908 GGGAACTGGGTGGAGATGCATGG + Intergenic
1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG + Intergenic
928818493 2:35329352-35329374 GTTATTTAGGTTGACATACATGG + Intergenic
931353354 2:61512204-61512226 ATGAATTTGTTTTAGATGCAAGG + Intronic
932640799 2:73443995-73444017 ATCAATTAGGTTTAGAGGCAGGG - Intronic
935149998 2:100425350-100425372 GTGAATTACGTAGAGAAGTATGG + Intergenic
937173908 2:119906949-119906971 GTGAATTCCGTTAAGTTGCAGGG + Intronic
937599364 2:123711597-123711619 GTGAATTAGGTAGGGAAGGAGGG - Intergenic
938281973 2:130070640-130070662 GAAAATTTGGTTGAGATGTAAGG - Intergenic
938332597 2:130459212-130459234 GAAAATTTGGTTGAGATGTAAGG - Intergenic
938357211 2:130661459-130661481 GAAAATTTGGTTGAGATGTAAGG + Intergenic
938433646 2:131268263-131268285 GAAAATTTGGTTGAGATGTAAGG + Intronic
943322265 2:186459596-186459618 GTCAATTAGGTTCAGAAGAAAGG - Intergenic
945627186 2:212224761-212224783 GTGAATTTGGAAAAGATGCAAGG + Intronic
947997774 2:234543424-234543446 GTGAATAAGGTTGGGCTACAGGG + Intergenic
1170938071 20:20826905-20826927 GTGAATTAGGAAGAGAGACAAGG + Intergenic
1172079810 20:32331271-32331293 GTGGATAAAGCTGAGATGCAGGG - Exonic
1172915296 20:38439056-38439078 ATGAGTTAAGGTGAGATGCACGG - Intergenic
1174421852 20:50404512-50404534 ATGCATTGGGTGGAGATGCAAGG - Intergenic
1179138891 21:38705383-38705405 TTGAATAAGGATGAGATGCTGGG - Intergenic
949735020 3:7161788-7161810 GTGAATTTAGGTGAGATGAACGG + Intronic
950112152 3:10426131-10426153 CTGAATTAGGTACAGAGGCAGGG - Intronic
951795989 3:26538956-26538978 GTAAATTAGCTTCAGATTCATGG - Intergenic
953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG + Intergenic
959020147 3:101179997-101180019 ATGATTTAATTTGAGATGCATGG - Intergenic
962146437 3:132844738-132844760 GTGAATTTGGAAGAGATGAAAGG + Intergenic
963618674 3:147576410-147576432 GTGAAATAGGTTGAGCTCTATGG + Intergenic
965449337 3:168818332-168818354 GTGAAATAGGTAGAGGAGCAGGG - Intergenic
965733255 3:171794471-171794493 GTGAATTGGGAAAAGATGCACGG - Intronic
967529898 3:190536716-190536738 GTGAATTAGGGTGACAACCATGG + Intronic
968243144 3:197111288-197111310 GTGAACTAGGTTGAGTTGGTTGG + Intronic
972598405 4:40550143-40550165 GAGAATTCGGGAGAGATGCAAGG - Intronic
973741137 4:53920417-53920439 GTGAATGAGGTTCAGAAGAATGG - Intronic
974958569 4:68672985-68673007 ATGAAGTTGGTTGAGATGGAGGG - Intergenic
975350829 4:73344041-73344063 GTGAATTAGGGGGAAGTGCAGGG + Intergenic
975832980 4:78389552-78389574 GATAATTAGGATGAGTTGCAAGG - Intronic
976208466 4:82643976-82643998 GTGTCTTACTTTGAGATGCAAGG + Intronic
978047778 4:104153381-104153403 GAGAATTAGATTCAGAAGCAAGG - Intergenic
979212139 4:118117811-118117833 GTGAATTGGGTTGGGAGGCTAGG - Intronic
979473176 4:121124999-121125021 GTGAATTAGGTAGAGGACCAGGG + Intergenic
980240617 4:130169521-130169543 GTGAATTAGGTTTTAATTCATGG + Intergenic
980802143 4:137765662-137765684 ATGAAATAAGTTGAGGTGCAGGG - Intergenic
990707255 5:58543333-58543355 GTGATTGAGGTTGAGAGGCCTGG + Intronic
992609383 5:78494214-78494236 ATGAATCAGGTAGAGATGCCAGG - Intronic
993056182 5:82982433-82982455 GTGAATTGGGTTTAAATGTATGG - Intergenic
994033702 5:95174637-95174659 GTGAATTACGCTGTGAGGCAAGG - Intronic
994303407 5:98173873-98173895 GTGAGATAGGATGAGATGTACGG - Intergenic
996771512 5:127091600-127091622 CTGAACTCGGTTGACATGCATGG - Intergenic
996892588 5:128439982-128440004 GTGAATCATGTTGAGATGACAGG - Intronic
996948026 5:129094028-129094050 CAGAAATAGGTTGAGATGAAGGG + Intergenic
997022526 5:130018394-130018416 GTTAAATAGCTGGAGATGCAGGG - Intronic
999550192 5:152678005-152678027 GTGGATTTGGCTGAGAAGCAGGG - Intergenic
1003004180 6:2365642-2365664 GTGTATTGGGGTGAAATGCAAGG + Intergenic
1003504064 6:6725446-6725468 GTGAATTAGGAAGAGATGTGCGG - Intergenic
1003766357 6:9241496-9241518 GGGAATTGAGTAGAGATGCATGG + Intergenic
1004500319 6:16203871-16203893 GTGAATGAGGATGGGAGGCAAGG + Intergenic
1005368070 6:25099479-25099501 ATTAAGTAGGTTGAGTTGCAAGG - Intergenic
1006621460 6:35367629-35367651 GTGAATTGGGTCCAGATGCTTGG + Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1016727512 6:147392170-147392192 GAGAATTGGGGTGAGAGGCATGG - Intergenic
1027771320 7:82410110-82410132 GTGTAATAGTTTAAGATGCACGG - Intronic
1032891657 7:136201174-136201196 GTGAATAAGGTTTAGGGGCAGGG - Intergenic
1034430990 7:151041073-151041095 GGGAATTGGGTTGAGAGGGAGGG - Intronic
1037243650 8:16805878-16805900 GTGAATTCTGTAGTGATGCAAGG - Intergenic
1038119558 8:24597412-24597434 GTGAATTAGGAGGAGTTGGATGG + Intergenic
1040413152 8:47175467-47175489 ATGAGTTGGGATGAGATGCATGG - Intergenic
1041710506 8:60889984-60890006 CTGAATGAGATTGAGATGCCAGG - Intergenic
1041752369 8:61274500-61274522 CAGAATTTGGTTAAGATGCAGGG - Intronic
1041886633 8:62816739-62816761 TTCAATTATGTGGAGATGCAGGG + Intronic
1044341984 8:91056165-91056187 GTGAAGTAGGTTTAAATTCAAGG + Intergenic
1045689997 8:104750570-104750592 GTGAAGAACATTGAGATGCAAGG + Intronic
1048414160 8:134207819-134207841 GTGAGGCAGGTTGATATGCATGG + Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1053106332 9:35412111-35412133 GTTAATTAGGTAGAGATGCAGGG - Intergenic
1055991431 9:82110609-82110631 GTTAAGGATGTTGAGATGCAAGG + Intergenic
1056033222 9:82575493-82575515 GTCCATTAGGTTGAAATGAAAGG + Intergenic
1060490287 9:124079172-124079194 GAGATTTAGCTTGAGATACATGG + Intergenic
1060565931 9:124591647-124591669 ATTAATTAGGATGAGAAGCATGG - Intronic
1062366630 9:136212677-136212699 GGGGATTACGTGGAGATGCAAGG - Intronic
1186166899 X:6836236-6836258 GTGAACTGGGGTGAGATGGAGGG - Intergenic
1188008601 X:25035816-25035838 GAGGATTAGGTTCAGCTGCAAGG - Intergenic
1188601108 X:31965236-31965258 GTAAATTAGGATGAGATTCTGGG + Intronic
1192399909 X:70824749-70824771 GTAAATTAGGTTGAGATTCCTGG - Intronic
1196145081 X:112307645-112307667 CTGAATTTGGGTGAGATGAATGG - Intergenic
1197679104 X:129363338-129363360 GAGTATTAGGTGTAGATGCAGGG - Intergenic
1199284860 X:146044466-146044488 GAGAATTTTGGTGAGATGCAAGG - Intergenic